Description :
From Genome Similarity Track
Location :
Scaffold_56:29267- 31842
Sequence
2575 bases(100 bases per row)
AAAAATAAAATCAATTCAAGATGACCTTCGATCAAATCTTGAAGTTCAAACCGGAGTTTCGTCTTCCAGCGAAGGCCGAATCGCAACCTTCGCTGCTTGC
GATGTTCGTAGTATACATCTAGGTCCGTATCACGAGCATGATCCGAAGCGGTGTTAGGAAACCATGTGGGTCGATTCCCACAATGCCTAGTATTAGCGTA
TTTTAAAGGTTTGTAACAGCTTGAGCAGTACCTCAAATCACCAAAAAGGATAGAGTGAAACCTAGGATCGTGGTCCTCAATACCAGCCAAGGGTTCTTGA
CGATTAAACGTAGCAATATGCGCCGAAAAAGCGGTGTGACCATTCGGAAATCGGGGGAGATTGTGACGAGCGGGGTAAAACACAAAACGGTTGGTGCTTA
AGTCTTGATGGATGTAGGTAGAAGAACTATAAATACTACTCCAAAACGCCGATCCAGCTCACCTTATGGGAATACTGTTGGAGATTGATGTTGCAGCTAT
GTGTATCTCAGTATGCACTTGCGCGTTCGCATATACTAGTAGGGTCATTTATGTAGTTCTGAGCACCGGCAGCCGGTTGGTTCATTCGTTTGGTACGCAG
GGTACCACGCGGATGAGTGAGGTTTCGAGTCGCCCCGATCACGCATTCTCTTTGTCATGTATATGAAATAGCGGAGTTTCTACCACGAGGTATTCAAAAA
AAATAATTACCTATTAGGTATATACAAGAAGTAATTACCTGTTCGCATGGGGATTTGATAGGGTAGAAACATCGAGTGGCTAGGAGCCATCAGGACAATC
GAGTGGCTGAGATCCATTTGGGTTGAGATAGGAGCCTACCAAATATATTACTTTTTGACTAGCACTTCCGGAGAAAAGCGGTTTTCATCTTTCGCTACAA
CCTAAGCTCTCAATCCAGACCAAGGCGAGAACTGAGCTCACGATCGCGGAGCGCTATTGAGGCATTAGGGTTCCCACTGATCGCGTAGAATTTTAGTACG
ATGGAGTTAGTCATACTTGGATGTCGGGAGTATTGACGGGGCCAAAGTTTTGTTCTATAATCTTATAGGTTCATAGACATCACTGGAAGACTCCAAAGAG
ATCAATCTTAATGTCTTCAGCCTGAAAACTCTAGGAAGAGAGATATGCGGGGAAGTCGAATTAGGAGAAGGGCTTGGTATATCCACCACGATCAGCTCGA
AAAAACGATCCTGTTTTGGACTATAGAGTACCGATAAGCCCGGTGATAGATGAGGACCGACCTGACAGGCATTCATGGGTGCTTTAAATCNNNNNNNNNN
GATCCTGTTTTGGACTATAGAGTACCCGATAAGGCCCGGTGATAGGAAGAAGGACGCGACCCTGACAGGGCATTCAGTGTGTGCCTTTAAATCGGATTGA
TCATTGCCAAATCAGCCTAGCTAGGGAGAGGATAGGTCATCAGTGCCATGACTTAGCGCTGGCGCAGCACTAGCTTCCCCTTTATTTTTTACGCTGGGAT
GGCGGGTTCTTGAACAAACTCGTTTTGCGGAAGTTCTCTTGGCCAGAGATCGCGATGGAATACTAGGATCGTTCTTAGTGGATCTCTCGGGTCTAGACGA
TGCCGACGAATTCCACAAAAGTCTGCCACGCACAACTTGGAAAGAACATTTGAGCCATCTCACCCCTAGAAGTAACTTATTTTCATGCAATGCGAATGGA
GAGAGGTGAAGACGGTATCCAAATATTAATTTTGAACTGATCCACGCTCGCCAGAAGGGCATCGCGACGGTGGATCGCACGACCGAACTCGGTTTTCAAT
TTGAAAAGTTGGATTCGACCCTGATCAACTTAAACTGATTGAGCAGAGAGCATGCAGTGTAGCCGATCAAGATCGGTGTCAGAGTCTTTCAGATCGTCCT
GAATCTTATCGCTCTTCACTAGAACTGTGTTAAGGAGATTATGCAATTGTCTTACCTGGTCGCTGGCCTGGGGACACCACTGTATATACTTCTACTTTTG
GACTTATTTTTAAAGAAGGCGGTAATCCTTCTGCGTTAAGTCCGCGTTCAGCCGGTCGTTTCTTTCATCCATGTGGCGCAGTAGATCCACAAGCTCCCGA
TAGAATTTCTCATGGGCAGAATGGCGTGATAGTGACTCATCGAGGAATTTTTGGATTGCGAGGTGGCGATCTCTCGTGTCTGAATTAATTGGGCGCCTAC
CTCTGCTCGAATGAGAGATACTTCTGCGCATTTTTCTTTAAGAGCTTCACCTAGAAGGTCGCAATGAATTTGGACATACATGACGTACACGGTATCCGAT
CCGTGAAGGTGGTGAAGCCCTTGCTATAATCGATCGTCACGACGTGTCTGCTCGTGCAATGACCACCTAAAACCCCTAAAGCTGTCCATAATATATCGTT
TTACGCGATCCATATGTAGAGAACAGCAATCGTTCTAGTCAGCGTAGCCTGATCGATAATCGGCATGCTCGAACGGGTGTCAGCAGTGTAATAGGCTTCG
TAGAGTCGAAACTAAAGCTGCAGATAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN