Description :
From Genome Similarity Track
Location :
Scaffold_159:29262- 32053
Sequence
2791 bases(100 bases per row)
ACTTTGTCGATGGAGTGACAGGTTACGTGGATGGTGAAGTCTGCCTTGCGGCCCTCCCATCATAAACTGCTCTGTTAGGGCTAGACGAAATGTCTGTAGA
TGAGTTCAGTCAGGCCTTGAGGGGAGGCGACTACTCCGATAAAGTGGTCCTTAGACTCAAAAATAAGTTGAACTCCTCGTCTCTCTTAGATGAAACGTTA
CTTGAAAGTACAAAGACGGCACTTAGTGCACGTAGTGGATCATCCATTTTGATGGATCCTTCAGATCCTTTCTACTCTTTGGTTAAGGAATTTCAAGATG
TGGTATGTCATAATCCACCGTCTGTATTATCCCCCTATAGAGACGTATGTCATGAAATTGACTTGGTTCCTCGAACCAAATAATGCGCTACACGACAGTG
GCCTTTACCAAAGGAACAGTGCGACGTCATTGACAAGGTTTTAGTGCTAAGCAAGCGGCGGTAATGGTGCGCGAGAGCAAGTCACCTCATTCCACACCGA
CATTTTGTGTAAAAAAGCCTAATGGTAAGTGACGTATTGTGCATGCTTATAATAAGCTTAATGCGGCCACTATTTCGTCACAAACGCCCATTCCTAGAAA
GGACGTTCTTCAGAAAAAAATAGCAGAATGTACAATGTACAGTGTACTCGACCGTGTCGGTGGTTATTATCAACTGCTCATGCTAGCAAGCGAAATCCCC
CTTACAGCGGTTAGTACTCCAAGCGGTATGCTTCGGGAGTGGTTGGTTATGCCCCAGGGGCTTTCCAAAGCCCCAATTACGTTTAATATTCTGGTGACGC
AACTGTTCCGCCCTCACCGTGGTTGTGCACAAACATATTTAGATGACACATTTGTCCATAGTCGGGCGAAACAGGGTCGGTCGGACGTGGATAACTATAT
CGACCATTTAGTAGTTGTGCTCGAGTGCATGCGCACTTATAAGATGTATGCTAATGAATCGAAATGTATCTTTGGTGCGGACGAGATTCCACCTTTTAGA
TGCTTCATTGGGAGGCGAGGTGTTCGGGCGGATCCTGCAAAGGTAAGAGCCATAGTGAATTGGACATTCCCAAAGAACCAAAAAGGATCTACGCAAGTGG
CTTGGCCTTGCCAGCTACTTACACAAGTTTTACGAGAATTACACTGATATGGCTCGGTCATTATCCAATCTCCTTAAAAAGGATGTGGAGTGGTTCTGGA
CTAGCACCAAAGAAGAGGCTTTTAAGGCCGTAAGGACAGTCTCCTACATGCCCCGAATTTGGCTTTGCCGGATTCTGATCAGCCTTTCAGTGTCGTCTGT
GACGCTTCAGATTTTGCCATTGGCTGTGCTCTGTTACAAACAGATGTTGAGGGACACGAGCGTGTCATAGCTTTTGAATCCCGTCGAGTTAAAGCTGCCA
AAACAAACTATCCAGTTCATGACAAGGAGCTACTTGCTATGAAACATGCTCTAGTCAAATTCAGAGTTCATCTGCTCGGCTCTAAGCCTTTTATAGGCTA
TACCGATCATTCGTCTTTACGCACGGCGACTCAATCGCCTTATCTCTCGCAAAAGATGGTCCGTTGTCTTTCATTCTTTGCAGAATATAACTTCGCGGTG
AAGCATAAGCCAGGGAGGCAAAATACCTTGGAACGATGCGCTGTCACGACGGCCTGACTATGAGCTGGCTCATGTCACAATTTTGGCGTCGTCAATTACT
GACTTAATCCGTGCACCTTATACTAAGGATGAACAATGCATAGATTTGCTACGAGCTCTTGGAAGCTATGAGGTGAAAGACTCGGACATTAAATTGTCGG
CACGTTCGCGTGCGATACTTTATCGATATTCTATAGATAACGGCTTGTTGTGCTATCGCACGGATACTGCGGACACCCCTCGTATCATTGTTCCTCTTGA
TGGGGAACGGAAGTATCAAATCCTATATGAGGTCCACGACACAGCTATTAGCGGTAATCTCGGTCGTGAGAAGACCTACAGCCTCGTTAGTCAGAGTTAT
TGGTAGCCCAAACTCTATAAATGGGTAAGCTCTTATGTGCGCACATGTGAAACGTGCAAACGGGTCAAATTTTCGACACATGTTACTGCGCCGCTGGCTA
GTTTGACTGAACCTTGTGGGTGATGGGAGCCCATCAGCATGGACTTTGTGTTTGTCCTACCAAAGGATTCGGATGTCAACATGGGTATTGTAGTCGTTGT
CGACCGTTTGATCAAAATGGTTCACTTAGCGGCTGTGCCGGATTCGATTGATGGGGAAGGTGCAGCTTCTCTGTTCGTTGATCGCGTGTTTGACAACACA
GACTGCTACTGGTAATTGTCTCGGACCGAGATCCTCTTTTCACGGATAAATTATGGAAGTACATCTTTAAGATGCTAGGCATCAGATTAGACATGTCTCC
ATCGGATCATTCGCAGACCGATGGTCAGGCTGAGCGCGTTAATTGCGTCCTCGGCGATGTCTTACGCAGCGTGTGCGCTGATACGCCTTGGCGTTGAATT
TCAATGCTCCCCATGGTTGAGTTCGCCATGAACAATTCTATCCATGCCTTGACGTGCTATACTCCGTTCCACGTGACCTGCCTCACCCCCCCCCCCCGCG
TTCCATTAACGCTACCACTACGTTGTTCAGGGATTGGTTGGGGGTAGGTAGCTGATCGACTTGCTGATGTCAGCCCTGCTACTGTTAAAAAAAAACGGTT
TAGCGCGTTCCTCACAACGCGATTGAATGTCTTACGACATGTGCGTGACGCAATGTCTGATAGCCAGGACAAACAGAAGGAACAAGCGGAC