Description :
From Genome Similarity Track
Location :
Scaffold_200:29262- 30443
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_15859Hypothetical protein
Sappa_CBS223.65SPRG_15860Hypothetical protein

Sequence
1181 bases(100 bases per row)
ACTCGACAAAATCTGCCAACTCGACGATTACGGCGGCGCCTGGCAACGGAACGTCCAAGTCGAACTCGTCGAACACGGTGACGACGCCTGCTCCGACAAA
GCCCAGCAGCGCCGCCGCGACCGGCGTCGCCCTCACTGCGGCGGCCGTGACCATGCTTGCGGCCATGGCCTAGTTGTGAGCTAGCGTTCTGTCGTAATCG
TTTTGAATCACATACATTTGTACATACAATTGCATCAAGGTAGTCTGGTCAAAATCGAGCTGCTCTCAGCAACAACCGTGGAGATCTCCAGTGTAGGGCA
AGACGGGTTGGTATCTAACGAATACAGCAAAATCCAGGGTGCCCTGCGCTTCGTTAATGGATTAACGTGTGAGATCCTAGATCTTGGTCTTGGAAAACCT
CGTCCACTTCGTCGAATCGGCCGTCTATGTGGCCGAGTGTCGCCATTGACGGACCGTTATCTAAACCTCAGAGATGATCGAAGACGCCATGCGAGCAGCA
ACATTGCATCACCAGTGCATCGATGTCGGTTATCTCCCCGTTCATCCCAATGCCTTCTCGCAGCATTTACCCAACAAACGAACTCAACAGACAACTGCCC
TGCTATGGACGAGTCGATGGATCAAGCGCATCAATTGTGCCCTTGAGTGCATGCACTTTCATTTGGCTAGAAGATAGACAAGAGACGACGAGGAGCTTTC
CGGAGCCACCGCCGTGGTACACGCGCAGCCACGAGGAAGATCGGGCGTGGTGTGATTGCTCAAACACGCGCTTCGTCTTTTCTGTCCCCATCGTCCGTAG
CCGACGCTGATGCCCTCTGCAGCATCGATTCTAGCTGCTCTTTCTGTGCACAATATTGTCCTTCTATTCGAATAAAGAACGACAGCGAGGGAAGCATCGA
CGTTGCGGGACGCGGGCCAGTTTTGATGACAAATCCGCGGCCGTGCCATTTGGCATCATTTGAAACGACGCGATTTGATTGGCCGCAGCCTCGGCAGGCA
ACAAATTGCAGTCACGATGGAGCCGGGAAAGGACGACAACAACAGCAACAGCGCGCAGGAAGAGGCCGCGCTCGAAGCCCACCTGCAGCTGCTCTCCGAC
ATGAAGGCCGTCGACACCTCGTTCGCGCTCAACTGGGCGACCATGCTCGGCGGCAAGCGCAGCGCCGACGCCATGGCCGCC