Description :
From Genome Similarity Track
Location :
Scaffold_159:29261- 32053
Sequence
2792 bases(100 bases per row)
TACTTTGTCGATGGAGTGACAGGTTACGTGGATGGTGAAGTCTGCCTTGCGGCCCTCCCATCATAAACTGCTCTGTTAGGGCTAGACGAAATGTCTGTAG
ATGAGTTCAGTCAGGCCTTGAGGGGAGGCGACTACTCCGATAAAGTGGTCCTTAGACTCAAAAATAAGTTGAACTCCTCGTCTCTCTTAGATGAAACGTT
ACTTGAAAGTACAAAGACGGCACTTAGTGCACGTAGTGGATCATCCATTTTGATGGATCCTTCAGATCCTTTCTACTCTTTGGTTAAGGAATTTCAAGAT
GTGGTATGTCATAATCCACCGTCTGTATTATCCCCCTATAGAGACGTATGTCATGAAATTGACTTGGTTCCTCGAACCAAATAATGCGCTACACGACAGT
GGCCTTTACCAAAGGAACAGTGCGACGTCATTGACAAGGTTTTAGTGCTAAGCAAGCGGCGGTAATGGTGCGCGAGAGCAAGTCACCTCATTCCACACCG
ACATTTTGTGTAAAAAAGCCTAATGGTAAGTGACGTATTGTGCATGCTTATAATAAGCTTAATGCGGCCACTATTTCGTCACAAACGCCCATTCCTAGAA
AGGACGTTCTTCAGAAAAAAATAGCAGAATGTACAATGTACAGTGTACTCGACCGTGTCGGTGGTTATTATCAACTGCTCATGCTAGCAAGCGAAATCCC
CCTTACAGCGGTTAGTACTCCAAGCGGTATGCTTCGGGAGTGGTTGGTTATGCCCCAGGGGCTTTCCAAAGCCCCAATTACGTTTAATATTCTGGTGACG
CAACTGTTCCGCCCTCACCGTGGTTGTGCACAAACATATTTAGATGACACATTTGTCCATAGTCGGGCGAAACAGGGTCGGTCGGACGTGGATAACTATA
TCGACCATTTAGTAGTTGTGCTCGAGTGCATGCGCACTTATAAGATGTATGCTAATGAATCGAAATGTATCTTTGGTGCGGACGAGATTCCACCTTTTAG
ATGCTTCATTGGGAGGCGAGGTGTTCGGGCGGATCCTGCAAAGGTAAGAGCCATAGTGAATTGGACATTCCCAAAGAACCAAAAAGGATCTACGCAAGTG
GCTTGGCCTTGCCAGCTACTTACACAAGTTTTACGAGAATTACACTGATATGGCTCGGTCATTATCCAATCTCCTTAAAAAGGATGTGGAGTGGTTCTGG
ACTAGCACCAAAGAAGAGGCTTTTAAGGCCGTAAGGACAGTCTCCTACATGCCCCGAATTTGGCTTTGCCGGATTCTGATCAGCCTTTCAGTGTCGTCTG
TGACGCTTCAGATTTTGCCATTGGCTGTGCTCTGTTACAAACAGATGTTGAGGGACACGAGCGTGTCATAGCTTTTGAATCCCGTCGAGTTAAAGCTGCC
AAAACAAACTATCCAGTTCATGACAAGGAGCTACTTGCTATGAAACATGCTCTAGTCAAATTCAGAGTTCATCTGCTCGGCTCTAAGCCTTTTATAGGCT
ATACCGATCATTCGTCTTTACGCACGGCGACTCAATCGCCTTATCTCTCGCAAAAGATGGTCCGTTGTCTTTCATTCTTTGCAGAATATAACTTCGCGGT
GAAGCATAAGCCAGGGAGGCAAAATACCTTGGAACGATGCGCTGTCACGACGGCCTGACTATGAGCTGGCTCATGTCACAATTTTGGCGTCGTCAATTAC
TGACTTAATCCGTGCACCTTATACTAAGGATGAACAATGCATAGATTTGCTACGAGCTCTTGGAAGCTATGAGGTGAAAGACTCGGACATTAAATTGTCG
GCACGTTCGCGTGCGATACTTTATCGATATTCTATAGATAACGGCTTGTTGTGCTATCGCACGGATACTGCGGACACCCCTCGTATCATTGTTCCTCTTG
ATGGGGAACGGAAGTATCAAATCCTATATGAGGTCCACGACACAGCTATTAGCGGTAATCTCGGTCGTGAGAAGACCTACAGCCTCGTTAGTCAGAGTTA
TTGGTAGCCCAAACTCTATAAATGGGTAAGCTCTTATGTGCGCACATGTGAAACGTGCAAACGGGTCAAATTTTCGACACATGTTACTGCGCCGCTGGCT
AGTTTGACTGAACCTTGTGGGTGATGGGAGCCCATCAGCATGGACTTTGTGTTTGTCCTACCAAAGGATTCGGATGTCAACATGGGTATTGTAGTCGTTG
TCGACCGTTTGATCAAAATGGTTCACTTAGCGGCTGTGCCGGATTCGATTGATGGGGAAGGTGCAGCTTCTCTGTTCGTTGATCGCGTGTTTGACAACAC
AGACTGCTACTGGTAATTGTCTCGGACCGAGATCCTCTTTTCACGGATAAATTATGGAAGTACATCTTTAAGATGCTAGGCATCAGATTAGACATGTCTC
CATCGGATCATTCGCAGACCGATGGTCAGGCTGAGCGCGTTAATTGCGTCCTCGGCGATGTCTTACGCAGCGTGTGCGCTGATACGCCTTGGCGTTGAAT
TTCAATGCTCCCCATGGTTGAGTTCGCCATGAACAATTCTATCCATGCCTTGACGTGCTATACTCCGTTCCACGTGACCTGCCTCACCCCCCCCCCCCGC
GTTCCATTAACGCTACCACTACGTTGTTCAGGGATTGGTTGGGGGTAGGTAGCTGATCGACTTGCTGATGTCAGCCCTGCTACTGTTAAAAAAAAACGGT
TTAGCGCGTTCCTCACAACGCGATTGAATGTCTTACGACATGTGCGTGACGCAATGTCTGATAGCCAGGACAAACAGAAGGAACAAGCGGAC