Description :
From Genome Similarity Track
Location :
scaffold_68:29261- 30469
Sequence
1208 bases(100 bases per row)
CACACAACATCCTTTTTTGCTGAAATCGGGTTTCTAATTGCAATACTTCTGACTGGAATACTCTACGCAATGAGTACCATGATCCAAGACGGAATAGTGG
TCTTGGGGCGGCTAGAAAATAACACATACGCATTTCTGCCTTCAACTCAGTCTGCAGAGGACGTACGTAGACTTCTCCTGGATCAAAACCTCGTAGAAGC
GACAGAAATGGTCGAACCACTCGCGTTCAGTGATACCCTTCGCGTCCCACCGCATCCAACTCCTGACACGGATTATCCGAGTCGATTTAACTTTACCGAA
CTGTACGACATGCCGAAGATCTTTGCGCTGGAAAATATTATGAAACACTCAAATGAGGCTTTGATTGAACTCTTTGCGTGGAACGAGACCTTCGTGACGT
CACACTTCGACAAACTCAAAGCTCTTGCTTTAACCGATTCTAACGCTACCACACCGTATACGGACGTGATACACAAAACAATACTCAACTCAACTGTGCA
GCAACTGATGGACCCCAACGGCGATGGTAACCTCGTGACCACGAACGATCTCTTGGATATCCAAAATATTTTCAACAGAAGTTGGCGAGGAGTCAGCGAC
CGAGGGGTTGAACTGAACACGCAGATACAAACCCAGTGGCTAATGGTTGCGCAGCTCTACTACCAGAAGCAGAAACTGGAGATGTATGTGGCGACTGTCT
CCAGCATCATCTCCAAAATCCACCCGCTACTAGGTAAGTTTTCAGCTGCAAAACTGAAAAAACAAAACTCTGATAAAATCTCCACGTTCTTTAGATGATT
TGATAGTGAAAACTAGTGCCATGGAAAAGGCGGAATTCCAACTCCAAGCCCCCGTCGAGTTCGTGACTGACTCGGTCCGCGCAAGTAAGATCGCCGACTG
TAGTTTCAATGGGAACTGTGGTACGCAACCATTTATTTTTTAATTTGTTCCGACCGTACTTTACCGTATCATCTGCCTGTGTTCGTCTACAGCTTGGCTT
CGCTCGGCGTTGAATGAACTGCTCGATCTTTTCCAGCGAATGGTGCAGAAGACGGAGCGTGCCTTCATCTGCTGCGCTGTGAGTGTCGTCACTCTTCTAC
TGTCAGTTATCTGTATCAACGCCTTCACCTCTAGAATGCGGAAGAATGTGGTCAAAGTGTACTCTTCCGGCTAAAGAAAAAAAAATCTTTTTCACAATTG
CAACAAGC