Description :
From Genome Similarity Track
Location :
contig_15:292607- 304880
Transcript NameFunction/comments
g3403.t1hypothetical protein F444_15242
g3404.t1conserved hypothetical protein
g3405.t1hypothetical protein, variant 3
g3406.t1hypothetical protein

Sequence
12273 bases(100 bases per row)
CCCAGCCATGTTCAATCCTATTAGTACACTTTTTTTGCGGTTGTACTTGTAGTCCAGATAAATCCCCAAACTCCTTCAGATGTTCTGTACAATTGGGATT
TCCTTCGCCCAACCAATTATCATACGTACTTATACCTGGATAGTTGAGGTGTGAGCTCCAACTGTAAGACGATAGGACAAACGAAGCCGATTCTTAAGTG
ACATCGTGCTGAAACCAAGCATTGAAGGAACACAAAGTAAAATGCGTTTTGGCACAGGGTGGCTTAACTCGACGACTGCATCCAAAAAGGTACACGTGAA
GTGCGTGCTACGATTACGGACGTGTGGAAAAGACTTTATTTGGCTCGAGCCACTACTATTAATAGTGTTCCCTTTATCTTCGTCAACAATGGTGGCTGTC
GCGTAGGTTGCATTGCTGCACTCAATGGTGATTATGGGATGCATGTAAAGATACACGTGAAGTGCGTACTATGATTATGGGATACTACACATTTACTGTG
TACTCATCGTGAATCGTTTGAGAATCTGGAAATTATTTCGTTTAGAAGTCCTTGGCGAATCCTTTTATTAAGGGCAGTGGTCATTTGTGCCATTGCACGA
ATGGATAGCTGAGCAGTCTTTTTAACTGTTATGCTTGGTCGTGAGGGATCCGTCGGCTCGTATCGATTTTCGAGGTAGTTTCTTAGCCTGAATACGGTAG
GCGAGCGAAGTGCGTTTTGGACCGCAAGCGCAATAATGGGAAACTAGTCCAATACGTAAAGTACAGGTAAGCTTCTAACCTAGTCGGCCGATCAGTGTTT
TTTGTTTGTAATTTGTATTACTCGTGTGTAATGCTCTAAAAGTCGGCAACCAGTTTTATAGTGCAGTCTGCCGAGCCATTTATAATACTATTTGTATTAA
ACTATTGCGAGCTCCAGGACTCTGCATCAGTTGTTTTGCAGCAAACCTTTTGCTAGAGCCACCGAGTTTAGTTGTTTTGCATGGCCTTTTCACACTGAGC
AAGAGTCAAACGTTTCCGTCTTCATCCGCAATCATACAGTTCACGAGGGATTGAGAGCTTTGCGTTTCGATCATCTGCCCTGGCTGAACTACACAATGTG
TACACATGCTGACGCGAATCATCACGCTTTCACAAGGGCTTTGGTCAGTTCGAAACTTGCGCTCCAGAGCCCAAGCCACACTGCCCTGCTGATCGACCCG
GACCCACCATGCGCTTTTGCTACCTCGTCCTATTGGCCGCAGTTACCCTCTTGCAGGCGGTAATGACGTTGCAGCCATCACCGCCGCGGACTCCAAGCAG
CTTGCTCAGCTGGACGCCGTTCGCTTGCTCGCTGAGCAGAACGAAGTCAATGTCGCCGTCAACCGCCTCCTGAAAATCGTCGACACGGAGGACGAGGATA
GAGCGGCGTCGGCGTCTTTCCTTACGAAGCTCAAGCAGGCTGTCTGGAGGATCAAGATTACTTCTTGGTTCCAGGCCAACAAGACCCCGGCGCAGGTTAA
CCAGCTAATGCTGAAGCAGGGCAGCAAGATCGACTGGGCTCTGGCTACCGCGTATGCATCGTACTTCCGCAACATGAAGTACGGCCCCTTCGCTATCGAC
ATGTATGACAACGTCAACAGCAGAAACGCGTAACTTAGTTGTTCGAATAGGGGTAAATGCCATGGAGCCCATGGCCCAAGCCATCGATAGTCGAGTTGCG
CACATATCATTGGTAATTGAATGGACTTGTAACCTGAAAGTAGCAACGCTAAGAGGCGTCAGCCGACATCAGCACAGACATAGGCATATGTGGGGGAATA
CGCGGAAGCTTCTACGCGAAAGCTTGTAAGCGAAGCTGCCGGACTACGCCGTACCGCGGTAGCCACTACCGACCGGCCAGTCCAGCATACTCCACCTCTG
TTGGGGTTCCAGGCAGTTCCAACCTGGAGCTGCAGCAGAGATGAAGTTGACTGAGATCCAGTGCCCCATCGCGCATTTTTCTCTTCTCCGATTTAGCTCA
GGATCAATGATAGGATTCAGGATGGTATCGAACCAGATCCGAAAGGCGATCCCAGCTTGGAACGCATATTGCGATTCGGAAACAGATGGACTAAAATGGA
TCGAAAGTGGACCGCAGCGGTGCATGCATTCGTTTCGGTGTCACTCTGCCATGGTCTGCTGGGTTTCTGCAGTTTCAAATTTACATTTGATTTGCTATAA
AAACTTCCTGTTGCCAGGCTGCATCATCCTACATGTACATCCAAGGGCGGCCTCACAGTTTTTGACATGCTTGCCACTACAGTAATCTGCGTTGATATAA
TACATGTAGAACATCCAAATACATCAACGCCTTGTGGCCGATGTAAACTTGTTTCTTCTATTATCTCTTCGTGCCCGGGGAATGAATACTACATGCATTA
GGCACTACCTACAGCGACATGCTCACAATTTTTACCTGAGCAGCATGCTCACAATTTTTACCATACTGCTCACATACCAATGGTAATGGGTAACTTCATA
CTGGATGGACACGATGTACTTCTTGATATGCCCGACACCATTCCCTTTGACCGCTATACACACCATTCCCTTTGACCGCTATACGATTTTTATCATTTCA
TGTATACTGTAATACTTCTTACCGACGCAACTTGCGGAGGACGTACAATGCAGCAACCAGAACAGATACCGATGATACTGCTGTGCGCATTGACGCGGAT
CCCCTATTCGTAGCCTGGTCAGAAATCTGCGGTGTCCCGGAATTTCCATTTCGAAGCAAATACTGCCTGGCATAGCGCAGCAGAGGCACTGTACGCCCCG
AACTCCACTTCAAATCCAACAGTTGCACAAATCGAAGGAAAATCGCGCAACAAGCCACCGAGCTCAACGCTGACGCTGCAGCAAACTGCACGAACGTAAG
GAAAGCTCTGCGACTCCCTCGTGACGCATACAACTGCATCACCAGCAGTGCACTTGACATCGCAGCCGTCCGATTAAGCGTCTTCGAACCCGGCATCTTC
ACCAGCTCCTTGCATCCGTTCCACATTCTCGACGTCACAATCTCGTTGAGAACCTGCTCACGCGTCGGTGGCGTACGCACAGTACTAACCACATCGGGCG
ATGGAAATCGAAACCTGACGTCGGCGTTGACAGCAAACTCAGCACCTGGTTGTGTTGCGCCTCAACTTGTTCGTCCCCCCGCTCCCTATTTTCCAGCACA
GTTAACGCTCCGTCGCCTGAGTCTGCACATTCACCCTTGTCTTCGTCATGGTCACTACTGTCACTGTCCTCCGCTGGAAGTAAAACTTTCTGCACGGAAT
CCGGCAGCAGCGGCAAAAGTCCGGGTTTCGTCAGCATGACCTGAGCCTCTGGCGGCATCTGCTCCATCAACCTCATCTGCTCGGCCCTCGTCAGCGGCAG
CAAAAATGGCACAAAGGGTGCCACTTTATCGGAAAAGCTTGTATCTGTGAGCCACTCCAAAAGTGAAGTTTCAAGTAAAAGTTCCCGTGTAGATTGGGGC
AGGAACCCTAGCAGCCCTTTTGTCCGCGCTTCTTCTTGGTACCATTTCCAGACGGGAACACTCCACGAGTACAAAAGCCCCAGCGAGGCGTAGGCCAGCG
CCACGAACGCGAGCATGGCTCTCCTGGATAAAAACTCAGCGAGCAGTACCGTGAGTGCAAAACTCACGGTGAGGCAGCTGGCGACACGCAAAAGCAGGAG
CGCTGCCTCGACTTTCGAGGACACTTGGGAATACGCGATATGCACCAGCAGCAACCAGGTCAGAGGCGGCGAGATGGCGACAAACACGACGAGGTGGTCA
ACCGCGAACGAGTCGAAGTCCAGCACCCACCCGTTGTTTGAGGGCACAAAACGCCTCAAATAACGTCGCGACTCGTCGTCCAGCCACGGCGCCAACGCGA
GCAGCGCGAAGCTCAGCAGTAGCAGAACCGAGCTCAGCGCGAGCAGCTGTACGCTCAGCGGGTGTCCGAAGCTGCGCCGCAGCACGTGGTCCAGCACGCG
CACGTACAGCGGCCGGGAAGACGTCATGGGCTGAAGAGAAGAATGTGTGGTTGAGATGACAGATCGGGGTTGTATGACGGAAGGAAGGTTTACCTCCATT
CTGTCATACAACCCTCATCTGTCATCTACTGTACACTTGCTTACGTGAAAGCGATGTTTACGATGTTGGCAAGACACATCTTGTGATTTATTGTGGTTTT
CAACCTTTTTGCCGCCTGTTTTAGCTCCACATCTCGGAGTGGCTTGTTTTACAATTCGGGCCTTCAATAGGGATAAGTCACTCTATCTTGGTGGGCCGAA
CAGCTCGATCACATACTCCTGCTCATTATTGCCCCTTTCGTCCGCCACACACTTGAGACGTCGTTTACGTGAATAAGGGCCACAGTCCGCCATCTAAATT
CGTCCGCGTAGGTTATGGTGCAGCGAAAATTGTGTGAATGGTTATAGCGTGTTGGTGGCGGGCTGAAGCAGGTATTCCACTCCTTTATATCGTTCATAAG
CGGCAAAACGGAAGTGTTGTTTTCATCTATGTATTTTGGCGAAACGGATGCCTCCGATCCAGAGATGCGGGGTCTGAGATAGCGGGCATCTCAGAGATAG
CAAAAAAGAGGGTCCGCAATACTGGGAGGAATAGGTTTATTAAAAAGCTGTGAATTCAACCCGACTTAGCACCTACCGTTTTTGACGGTTTCAGACGGCA
TCAACGAGTGGTCTTCCTGCTTCAGCCCACTCGCACATTTTTCTTTCCACCATGACGCTTGGAGACGATTTTCGCTGGCGAGCCATAGCTTCGATGCATG
TCTACAACGTGTTATCTGTGTACGTTTCAGAGCTATTTAGACCGAAACAGCGGACGCTTCGCCGTCGGGCTTGGCTGGAGACAAGTCTCCGATTTGGGCT
ATGAAATAAATCAACCTAGCCCCATGCACAGGTCCGAATTCAAAACTGACCACTCAGAGTTGTCCAGCTAAAACGGGCGGCAAAAAGCTCGAAGAGCACA
ATAGTTTCTTAGCTAAACACAAATACGCGTACAACATGTATTGTGCTTTGCAGCCAGTTTGTCCAGCTATTTCGTGCATTAGTTAGTACTCGTACTTAAA
CCATAGAGGCTTTGAGTGGGTCTTTCCGAAGTCATGTTTCATGCACGACAAGGGCAGAAAATGGCGCTGTTAGAATACTTTCAGATCTCCCAGACACATA
ATGGGCGAGTATGAAGCATGCACGATTGACAGCAACTCGAACTCGAGTACGATTTATAGGAATCTTGTGCAAGACAAGTCGTACGAATTGCCAAAAAGAA
TGCACAATAATAGAGGACCGAGTCTTTTAAGAGGTATTTTAAATACAGTACACGTAATAAATACATTGGAGGTACCCCCCCCCCCCCCAAAAAAAAAAAA
AAAAGAAGAAATGTTCCCGATGACTGTAAAGTTCGCCCAATCCTGTTTACTATCGCAGCAGAAAGCATGCAGTGATGAGAAAGACCTATTCCCTCATTGC
TCATTGAATTGAGACATAGTGTGCCGATATCAAGCCAACAATTTATTTTAATAGGCTGTACTACATGTAGTACTCTAGTACAGCCTATGATTGATCGTGC
TTGTCGCGATGTGGGACCCGCACGCAAAAGTATCTTGCTCGTGCCAAGCCACATTTCTCCAGTACTTTAGTAGAGCTGTGCGCTGCGCGGAAGCAAAGCC
TCAAGATAATTCAAGGCAGTTCGCACATGGGAAGTTCGTTGTGACCATCATGATGCAATGACGCTCATCCGAGGTGCCTGTCGCCGCAAGAGTCTCGCAC
CGTTTGTGTGGTACCGTTTATATCGTTCTGCAGCTCTCGCGGTAAAATTTGAGATTACAGCCGTCGAGACCTCGATTATCGCAGATCGAGCTAGATGTGA
CCCTGGGTTTAAGCCACAGGCGTCGTTTAGCTTCGCTAACATAACCTTTATTGTGCTTTTCATCCATTTTGGCAAACTTGAGTTCCATTCCCGAGATAGA
GGGTCCGAAGCAGAGATAAGCTCCGAGATAGCAAACGACTAAGTCCGAAATGTAGCAAGGGGGAAGGTTTGCTCTGCTACTGCATCCTGTTATAGAGGCT
TACATGCAGTCCTGGTTTAAATACACATGCTTCGGAAACAACATTTGTTTAATGGACCCCGTAATCACCGGAGAACAAATCAATTGTACAGCACAGACTC
TTCCGATCGGTTTGCCGACGTGTGAAACCAACCGCCTTGTGAACAATTACGGTACATGTACAGATAACGACGGATCGTGGGCCGGCGGTACCATGGTGCT
TAGACCTCAGTTTGCAATTTACTCTCCACCCCACAAGCACCCGAACACCAAGAATCAACACTTAGCTATGCGCTTCTTCTACGTCACCCTCGTCGCTGCG
GTCACGCTTCTTGCAAGTGCCAACGCTGTCTCCACCAAGCAGAACCAGATCTCCGAGACGTCGCCGGAGATTGTGGCTCGCTCGCTCGCTGCCGCCCAGG
ACGACGCTGCTGTCAAGCGTAACCTGCGCAAGTACGTCGAGGAGGACGACCTTGACTCCCTCGACTCCCTCGACTCGTTCGATGAGACCGAGGAACGCGC
AAAGGTGATCAATGTGAAGCAGCTCAAACAGCTTGCTAAGACAAAGAATGCGCATCTACCGGTCAACTTTGCGAAGCTGAACTTCAAAATGCAAATGAAC
ACGGTCAAGACTTGGGCAAAACAAAATATGAACCTGAAGCAGTTCGCCACAAAGCTGGGACTGAAGAGCGTGAACGACGTCGGCAACAAGAACTACCCGG
TTTTCAAGATGTTCGAGGGCGGTTTACCTAGTCGTAGACGTACTCCTTCGCTAGGCAACCACGAATAACCGATTTTGTAGCCGACGCTTAAATCACTTGT
ATCGAGCATTCATACGACAGTTTGACGACAGTGCTAACTAAATGATATCACCGGTCAATAGTATCCGGCAAGCGCGACAAAACTGAAGCAGAGCGTTCAA
GTAAGTGCATTTATGCTTGGCGTCTTCTCTTCCTCTGTCTAAATGCTAAATTGCGAGCGTTGCTACTCTGTTCGTGTTCTGTCTCCCTAACTAGATGAAA
CATTATGGTGATCTTGAGTTGTGTTAACCGACAAGAGCGACGAGAAGAGCTAATCAGCAGACCGTTCACCCAGTAATATACCGCATCGCTGCCTGCTGTA
CAGTCATAGAGGTAGGTGGTTGCGCCCCAGTCTCGCGTTCAATTGCTGCAGAAGTGTGCTGCAGCATAATTCGCCACTCTGAATAGGTTTGCCGCTTTCT
CCGTGTAGGTAGATCACCTGCGCCTGCTCCTCCTTGGTTGCGCTCAGCTTCGATGCGCTTCAGACCGGCGAAAAATGTTTTCATGCCATCAATGTAGGCA
ACAGCGAGTGGCAGTTTCTTCTGCCGGAAGACGTCTTTAATAGCACTTCGATAGCCGCTGAGGGTTGTAACCTTGAGAGTTTTTTCAGTATCGTCCGTCT
TAGCTAGCAAAAGGCCTCACAATCTTTCGGCGTAATACATTGGCGTCAATTTCACCGTTAGAGTCAAATACCTCGCAGAGTCCGTCTTAACCGCATGGAT
CCATGCAGAAATACCGCGGCGATAGCTGCGGTAAGCCGTTTGAGTCCTGGAGGTTGTACATGCGCGGCGAACGTTCTCCGCGTTGAAAAACTCGGTGGGT
GGCGTTGAGGAGCTCGGAGTAGCACCATTGCTTCTCGCAATAATGGTGGGGTCTTCAGGGGAGGACAATCACGCAGAACGAGATGGGGGCATGGGGAAAT
GCTGGGGGCTGAGGGCTGAGGGCGGGAGCTGGAGACTATGTGAGGTGCTCTGAGCGATTCTAGCCAACGATATAGCCCAGTCTATCGTACGACGAGTTGT
CGTCACGCTGTCAGACGGCGGCTCTCAAAAGACAAGATATGTCTTACGAAGGCGCATGAATCAATGATGCTACAGTAGGCAATGCCGCGATGATAATACG
GTACCATAGTGTTGGAGATATTCTGGTGGATTACATGTTATGTTGGTCGCAGGAAGACACATCGTGTGAGCAAGAGCTTGCTGCTCTTCTTTTAGCAGAG
CTGCGCCAAACAAAGCTCTACATGTATGGGGATAACAGGAGCGGTGACGGTCTCTACTTGCTTGGAACCGATACATGTAGCGTTTTGTTGTCACCTGTGT
GGCGACGATGGATTTGCCACTCTCTGAAAAGCAGCGAACTGATTGTAACAGCAGAGAAGCAACATTATTCATCGTCTGCAATTTCCACAACGAATCAATT
GGAAGTTTCCAATGAAGTCGTCCCGCAGATGGCATGCAGTGTTCAACGTCGAATTTTGAATCGATGTTCAACCTAACTTGTGTTGGTACAGATGTCCCTC
CAAATCTGCAATGGTCGGACCAATAAAGACTGCTAGGTTACTAGATTAGCATAGGAATACATCAAGAGCCAAATGCACTGCATTATTCCGAACTACACGA
CTAATAGCAGAGCATGTGTGCAACCTGCATGCATGCATGCTTCCCAAGACCGGTAAATGTAACTTAGATTAGTACAGCATCGCGGCAGCCAGAGCAAATC
TTCCGCAGATCCATACTATCTGTGCAAGGAAATTGCTGTACGCAGTTCTCCCTTTGCCGGGGAACTCCGTACATGTTTTGAGAGAGAGAGAGAGAGGTCA
GACTTGTCTATTTAACTTTACGGTTTACAAGATGTCTGGCATTTTCAAAGCCAGGATAGCAACGCCGATATCGGTTCTCGCCCGGTGGTTGTACTTGACT
CACCGCCGATGGTGGCGCCTCTTTTGATTGTCTCGACCGTATTTGTAGACAGATGAGCAATCGTGTGCCCTGAATTATGGTGTGCAGTCCTCTTCGTTCT
CGTGTTGCCAACGCACGTATGTGTCTGAGTCCAGCGTTTAGAAATTCTTGAACGCTTCCGTGCAGTGTGACCTTTCCACCGTCGTGAACGACTCGATTAC
GTTGAATCCATAGTACTGTGATGCAGGTGGAGCTGAGGATCCACCATACCCTTTTCCAGTCTCCTTCATACTGCTCCGGGTTATCCGCTACTGTTGCCTG
GAGTCGCTGCCGGATCGCAGCGGGTATCTTCGGCGGTTTGCGTGATATGCAATTTCCCTTGAAATTTGCGTATGTGCTGTTGTGCCCAGTCTTGCCCTGT
CCATTGACTGATGAGCGCTCGCCAGCAGGCTTGTGCAGACAAACAGTCCCAAATGATGATCCTTATACGTGTTTTGCAAAGGGGCCAGAAAAAAATGTTG
ACGTTGAAGCATATGAAAAAATTCCGCTCAATTGAAGACTGGCTTGTTAGGCTCGGTGAGGTTTCGAGCTGATAAGCGCACAGAAAGCTTCGACTTGATT
TCAATCGATTATTTTCTAATACTACGTGTGCAAGAAGAGCCTTCACAGTCTGAAGAAGCCTATCTCATCTCCGACTTGGCCTCATCAGTCGTAAAAAAGG
CTGTGTTTCCTCCTGTAGTAGTACACCTCGTATCCATCAGCAAGATCCCAGTCGACGTAGCGACCTTGCGCCTCCCGGTTCCGCAGCATTTGTTTGACTT
CTTTCGGGTTCATCCCTGAGCGATACCAACCACGGTACGTCGTTTTCGCGGCATACCGATTAACCAAGTAGTCGAACAACCCCTTCTCCTCGCTGCCGTC
TTTGGCGTTTTCATCGTCCTCCTTGCCAACGCTCTTGTCAGCCCGCAGGCGTCTCGTGCTCTCAACATCAGCAGCGAGGGCACGGACAGAAGCCACAGCG
TTAGCTGAAGTCACTTCGCCGATGTTCTTTTGGTCAGAGGCCGAGACCGTGTTGCTGCCCGCCAGAAGGACAGCCGCTGCTGCTAGAACGAGGTAGGTGA
ACCGCATAGTCGTTTGAGATCGGAGCTTTTTGAGGCTGGGTTGCTTGAGCTCTGTAGAGTGAATTGCGAAATGGAAGTTCGTAGGAAGCTACCGCATAGG
AATTGTTTACACTATCCGCGAGCCGTCTTGCTGTCCGCATTGAGCGTGTAGGCAAAGGTGCGGGCTTCGCAACTGCCGGCAAAGCTCATGATGGCAGCCC
AGGAAACGTATCTTTTCCCCTGGTCTAGAAAAACGGCTGGCTTGGGCCTGGGAAGACTTAATCGCACTAATTCACAAATCACAAATTTAGTGTCGGTCAA
TTCCGACCCGGAAAATGGCCGCGGAGCGCAGCCCGCAGAGTCTCTGGCGCGCGGCGGCAGGTGCGCCCGCCACATTCCTCACACCCTCCCGCATCTCCTC
TCTCCAACGCACTATTTGCACGCTCCAACCTTTTGTCCCATAGAGAAATTGGCCACCGCCGACTTCCTCCTCGTTGCCACGGGCGCAGGCTTCTCGGCCG
ACTCGTCGCTGCCAGTGTACGCAGACATCGCCAAAGTGGCGGCCTACGAACAGATGGACGTGGAGTACCAGGACCTGTGCGACCCGTTCATGCTGGAGCA
GGACGAGGAGATCTTTTACGGCTTCTGGGGCAGCTGCACTAACTCCTACAGGGACGCGAAGCACCACGCAGGGTATGAAATCCTACGCCGGTGGAGAGAC
ACCATGAAGGCGAAGGCTACGGCCACTACAGGCAGCAGCCGAAAGGAGAAGCAGTCAGCTTTTCGAGCGGCTTTCGAGCGGCTGAAACAGTGTGGCGATC
TTCCGAGAGGAGTCGCCACGGATTCCGTGACGAACGACCCGTTCTTCATCTATACGTCCAATGTAAGGTGCTCGTTAGGGTGAAAGGAGACGGCTGTTAA
TGCTGGCTTGTGGCAGGTGGACGCGCACTTCCGGCGAGATTTCGACGGCAAGGAGATCTACGAGCTGCATGGAAGTGTCGAGACGTGGCAGTGCGCGGGA
GACGTCGAGACTGGCGCGAGAGAGCCGTGCCACAAGATCTGGAAGCTGCCGGCGGACTTCCGCTTTGATTTAGATGTGACCACAATGAGAGCGCCGGGCG
CAGATGCGACCACGTGCCCCGAGTGTGGAGGCAAAGGCCGCCCCAATGTGCTCATGTTTCATGATAGGCAGTGGATTGGAAACGTGTCGGAAGAGGTGGG
TGTGCTGCGAGGGATTGGCGAAGGAATGTGTGGCACGTTAATGCTCATCTATGCTCGTGCTGTATTATGCTGCAGAATGGCTACATCGCGTGGGAGGCGG
TGATAGAGCTGGTAAGTTGCTGAGCAAGTTATCGTTATCTACGTGTCTGCTCATACTACTTGAATGTTACTGCTCTACTACGTGCTCTCATTGCTATAGA
TGCTGCAAGAACACCCGACGCTCAATCTAGTTGTGCTTGAAATCGGCTGTGGAACTCGGGTTGGTGCCATATTCGCTCTAGGCACAAAGGCCGTGTTGAA
AAATGTCCTCATTCTGGTTTTGGTGCTTGCTCTAGGTGCCGTCTGTCCGGAAAGAAACAGAGATGGTTGTCGCGGATGTGCTTCAGGCCTGCGGTCGTCC
GCAGGCGACGCTCATCCGTATCAACCCAGACATCCCAACTTGCAACAATCCGGTCATTTTAGCGAACGACCGCTTCCTTTCCATCCGTTCAAAGGGTTTG
GAAGCTTTAGAAGGCATCGATCAGGAACTCCGCAACCTTCGACCAAAGGTATAATGATAACAACGTTTGAGTTGGGCACCACGAGAGCGGGGCAGGCGAC
ATGATTTTATATCGCGACGGGATTGTGGGCATCGATATTGAACTCGAACCCCGCGAATTTTTCCTGGTCTTCTGACGCGATTCGATCTGATCGCGAGTTT
ACATTGAGTACGTCATCGAAGTCCTGAGCCGCTGTATCGCAGTTTGCCTTCTTTTCATCCACGACGGGGACGAGAGGTGGCGTGGCAGTTTGTGCCACGT
ATCCATCCCAGTCGAAGGTTTGCAGCCAGTCGTGCTTCTTGATTTCTATAATGCCATCAGGACCTGCACCAAGTCGCTCGGACTCCATTGGATGCAACAA
GCCTCGCAGAAAGGAGCGACAGCTCTGTGACAGCTTGGCATTGGACCCAGACGTGCTGTCCAAAAGTTCTATCGGGTAGTACCTGTCGAATACACTCTCT
GAGAACTCCTTGATGACGTCAGGGCACTTTTCGAGGTGCGAGCGTACGCCGCCATTCCATGGCCTCCTCCCAAGCAGCAGCTCATAGGTCATCACGCCTA
GACTGAAAAAATCTGACGGCGTGCCATGCTCTGTGGATCCCCGGAAGATCTCTGGCGCCATGTACGACACGGT