Description :
From Genome Similarity Track
Location :
contig_54:292536- 293942
Transcript NameFunction/comments
g11294.t1hypothetical protein

Sequence
1406 bases(100 bases per row)
TTATATAAAAAGACGAATATCGATCTAAAAAAAGGGTAGCTCATTGGTGATTAGATAGGTTCTTGTAGTAACATCTATAGTCAAATGAAGTTAATGAATA
GATTGAAAACAAATTATACAAAATTACGTTGTTGTCGCGGCGCTAATGATTCATATACAATACAAGAGCATGTGAAATGGAATTATCTCCTTCCTCCTAG
TCCTTTGAGCGTCTTGCTCTTCTGTGATCCGCCGAAGCTTGTTATCTTGTATTCGTTCTTGACCAGTCCCGCATTGTCCAGCGCGGGACATTGCTTTCGC
CGATGGCGGCAACAATACCGACCTCTGCTACTCGTCTAAGTACTTGGCGCTTAAACTGCATCTTGTACGAGCGCTTGACACGCATTGTTCGAGTTTGAAA
ATGCTCTCAATGCTCGCTGGTCGCGATGTCCTTGCGTCCAGTAATTGCAGATTTGTGTCGTTGGTTAAAAAAGTGAGTTTAGGTCAATCTTATTGGCATA
ATAAATAATCCTCTTTGTATCAGACCAGAAGTCAGGAATTGTCGCATGGCGTATTTTTAAGTAGAGCGTATTTTTCCGTTGTTGTCTGTATGCGGGAACA
CTTGGTTCAGGATGGACGGATGATGTCGAACAGACGTTAGGGTCCACGCACACATATCTGATAGCGGTGGCAGGAGCTCGAGGTGGGACGCCATCAACGG
CACCATAATTGTCAAGATCCACCTAAGCAACGGCAATTACCGGGTACAACAGGCGGGCAGTACGCTCTACGCCGTGGTAAACGTGACACTACTCCAGGCA
GTGCATCTGGGAATGCTCTGGGGTCTTCGCCGATGTTGTAACCAACATTGGGAACCGGCACACGTAATGGGAGATCATCCGAATGCGGTTACACAGCACT
CGAAACGGCGACCTCCACGGGCGCGGCATTTACAAGGCAACTATTGGGAAGCAAGAAGGACGGCAGACGCGGTGGGTGTCAGTAGTTGGACACTACAACA
CCGAAAGTACAACAGGGCTGCAAACGCCCTGGCGCGTTTGGCACGCGCGTCGGGCCAGGATACGGACTGGCAAGGACACGCGCTACAGACGGCTGGGGAG
AGCTGCCTCGTCAAAGACGATGTGACGCAGTGGTTTCTCGACCACGCGAAATGGACGGATATGCACGTCGTGGACGCTACAGTATAACCTTCTAAGGGGG
CTAGCCCCTGCCACAGGCAAGCGGACGGCAAGCAAACTCTCTGATCGCACTATTGGCATCGCAGGGCACGGACATTAGGCGGCGTTAGCTCTAGTTAGTT
CATTGACATTAATGTACCTAACTTCAAATTCATAACATCCTCTTCATCTCGCTCAACTCGTTCACGCTCGTGCTGTGCGTCGTGTTCAACCCGAAGTCGC
ACCCGC