Description :
From Genome Similarity Track
Location :
contig_113:2925- 3930
Transcript NameFunction/comments
g13783.t1hypothetical protein

Sequence
1005 bases(100 bases per row)
ACCTCGCGACACGCGAAGCGCGGCTGTGCATGTACAATTGCCCAGGCGGGTGTCAACTTTGCTGCCGTGTGCGCGCGCGCGACCCAAGTGACTCACCTCG
CGGAAGATAGCGCGGCGCTTGGCACGGCCAGCCGATCGCCTCTAACCCGACTTGGCCGGGGCGTCGCGCGACGAGAGACCCCGCGCCCCGGCTTGACCGG
ACGCTAGACTGTGCAGCCGTAATCCCAGGCGGTCCGCACCATCACGACAGCCGCCCTTGTCTCTCGGTCGGAGCGGCGCGATGTGGTCTTCACTTTCACT
TTTGCCCTCGCAAACCGCATTGACTCACGCCCCGTAAGCGTGCAGCACTGCTAAAGCCGCCATTAACGCACCATGTCGCGCGTTGCAGCCATGAAGCAGC
CGGAGCCCGTGGCTCAGGACCCCGCAGACGGCACGCCTGTGAAGGAGGTGGCGCCGTTCCTGCGCAGTCTTCGCCGCATGCTGGACACCGAGAGCCCGCG
AATTCTGTGCTGGACGCCCGATGGCAAGGCCTTCGAGATCCACGACATGGCCGCCATGACGGGCTACGTGCTGCCCAAGTACTTCAAGCACCGCAAGTAC
GCCAGCTTCCAGCGGCAGCTCAACTACTTCCACTTCCGCAAGTGGACCAAGTCGCGCGCCGTCGTGTGCACCTTCTCCAACCAGTTCTTCCAGCGCGACC
AACCCGCGCTCACTTGGCGCATCACGCGCAAGCGCGCGCTATCCCCGGCCAAGCACTCGTCGCCGCGCAGCAGCATGTCGTCGGAGCTCGAGGCTCGGGC
TCCGACTCCGACCCTGCAATTCGCCAAGCAGCTTGAGCCAGCAGTCACGGTGCTGCCCTCGCAGCAGCCGGAACTGTTCGACGAGGATGCGTCGCTGGCC
TGGATCGACGTGCTGTACCCGGAGCTGAAGCTCGACTTGCTGGAGGACGACCTGAGTCCAGCCGACTGCTTCTTCTCGGCGAAGCTGCTCGGGCTGTAAG
CTGCA