Description :
From Genome Similarity Track
Location :
Scaffold_1180:2924- 4901
Sequence
1977 bases(100 bases per row)
GTCAAGAAGCCACAGGGCAGCTGGCGCATCGTTCATGCGTACAACAAGTTGAACGATGCGACGATACCGGCGCAGACACCAATACCGCGAAAATATGTCA
TCATCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGATCTGCGCGATGGGTTCTATCAGATCCTCATGCGTGAGAGCGACATCCCTCCCACGGT
TGTGAGCACGCCGATCGGCATGCTCTTGGAGTGGCTAGTGATGCCGCAGGGTCTGAAGAACGCCTCTGCGACCTTCAACAGGTGCATGACGCACTTGTTG
AGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGATGATGTGTTTGTCCACAGCCGGGCTGCGGACGGGATGAGCGATGTTGAGATGCACAAGGTGCATC
TCCGGAAGCTGCTTGCGCTCATGCGCAAGTACAAGCTCTATGCGAACCTGAAGAAGTGCATCTTCGGGGCGAGCGAGATACACGTGCTCGCGTGTCTCGT
TGGGAAGAACGGTGTCCGCCCTGACACTGAGAAGGTCAGAGTGATCAATGAGTGGCTGACGCCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTG
ACCACGTACTTGTGCAAGTATGTGAAGGACTATGCGGGCACGATTTGCCCGCTGTCACAGCTCCTGAAGAAGGAAGCCGAGTGGCATTGGGCTGCTGAGG
GTCAGCAGGCCTTCGATGCAGTCAAGTAGGGCTTGACTGAGGCGCTGATCTTGGCGGTGGCCGACCAAGATCGCCCGTTCCACGTTGTGTGCGACGCATC
CGACTTCGCAATCGGATGTGCGTTGATGCAGCACGATCACGACCCTCGTGATCGTGTCGGCTACTACCAATCGCGTCAGCTGAATCCAGCTGAGCGCAAC
TACCCGGTGTATGACAAGGAACTCCTTGCCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAAGAAACCGTTCGTAGTCTATACGGACC
ACGCGTCACTGCGAACGGCTGTGAAGTCACCGCACATCTCGCAACGGATGGTCAGATGGCTCTCATTCTTCGCAGAGTATAACTTCCGGGGTTGAGTACC
AACCCGGAAGACTCAATGGGGTGGCCGACGCGCTATCGCGTCGACCTGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCCATGCGATCGAG
CACCCCAACGTCGTCACTGTTGGACGACGTGAAGGTCGCGTCCGCGCACGACGCGGACGCGAAGTTCTTGCTGGCCCGTCAGAAGCTGCCGAAGCATCTT
CGTGCTCGTGCATACCGATATCGGGTGTACGACGGGTTATTACTCTACAGTGCAGACGACGACAGCGCGGACTTCGTTGTCGTGACCAATGACCATAACC
TGCGACTCAGGCTCATGTATGAGTATCACGATACCGAGTGCGGGGCATCCGGGCCGTGAGAAGACATATCTTCTTCTCACGCGGGACTTCTACTGGGCCC
ACCAGTATAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACATGTGAAGCCTGTGCCTTTCGCGCAGGCTCCCTTGCAGACACTGCCGAC
TCCGTCGGAGTGTTGGTAGTCCATATCTTTGGACTTCGTGTTCGGTCTTCCCCCGGGCAGCCAGGGGAACACGGGCGTTGTGGTCTTTGTTGACCGCTTC
AGCAAGATGGTACATCTTGCTGCAGTACCTGCTGAAGTGACTGCGAAGCAGACGGCGCGTCTGTTCGTTGACATGGTGTTCAAACACCATGGTATGCTGA
TCGACATTGTGTCGGATCGAGACCCGCGCTTCACTGCACACCTTTGGCAAGGAGTGTTCACACTTCTTGGGAGTCAACTTTCGATGTCGGCTGCGGACCA
TCCGCAGACGGACGGGCAGACCGAGCGCGGGAACCGCGTACTCGTAGACGCGCTAAAGAGCTACGCTCACTCGTTCC