Description :
From Genome Similarity Track
Location :
Scaffold_14:292374- 295152
Sequence
2778 bases(100 bases per row)
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnga
agactgtcgccctaagctcgactgaggccgagtacatggctctgagtgactgcgtcaaggaagcggtgtggatgcgactacttctcaaggacattggtgc
agagcaagtgggggctacggtgatctacgaggacaaccaaggtgccatggcgttggcgaagaacgtcggttaccaagctcggaccaagcacattgacata
cgctaccacttcattcgtgagaaggctgtgcgtggtgaagtcaagctggagacatggaaatcaagcaccagctcgcggactacctcaacaaaggtctgtc
gtcgaagactctccgctcttgatgatgcggagcaatgtggcccccaagctcgagacgtcgaattgagtggaggtgttgtggttgcacttcgccgtctacc
tcgactgacatgctacctcagggcacacgacatgctcgcgccttgagaggcatgcaattgaagtagagcgaaagagtgcatgtgattggcggatcctttt
gtatcgtgagatgtgatttggcgtgcggcttcaatttgcgcgacatgtggtgatttgcgtatgcatcgactggggtcaccgtgtccgttgcaactggccg
tgtccgttgcatattgggatttatatagggatttgtattgggacttgtataccggtgtatacaagtgtgttcgttgcaaattaccgtgtccgttgcagat
tacggtcaagtgaacgaagggaggtacaaggtactcgtagacctggcatgtaggaggcatgtaggagagagagaaagcaagactaggacttctaactaaa
tggaattcactttcggatttacattccaacataccaagcttcgttcgctactctcaattccctcgataaatttctgttgtctactgcgtttattcgctaa
taacacgttgtaaggacgttccctaagcaatataggagccttatacttgaacggagccacccgctggaatggctaagattaaagcaggtggtctcttaaa
agcagtgacaattcgatttttgagccaaacactatatgaacaacgagtgcacgtaactcttgtagttgtcagattctaatgatctagtagtgctaacaac
aacattaaaggctacaataagcgcaacaatctaaacaaacacctacaggtcaatacaaacgcaaataaaatattcgttcgcatatcttttgtcagtccgt
cccgaaaggcgtttttctgtggattaatcaatttttatgcgatttcaacaaaacgaccgaagaagctgggacagctgcatcgattggtcaattattatag
catttgcgcacttctactggctaaaatgcgaaaatatgtcttgcgtataattagtgctggcactgaatggcctccttcaatctcttcgattccaagcctt
cgtaactggggtgcctacgtgaggaatgaatatacgtcgtggaagttgcatggaggtgttcattccagttggtctcacgcagaaaacgtcagacttccga
tttacgtacttatagcgcaacttgtagtatattgaaaaatcctgcaatgattggtgatgcgattgcaaattttcgatgtctatgaagcagccgtgtcgtt
aagctatcgcctaccgaagatagatcaaggtcctacatgtagcaaacgcagacgggctgtttcacagaaaaccgaaag