Description :
From Genome Similarity Track
Location :
Scaffold_40:292372- 294082
Transcript NameFunction/comments
Phyra_79457Hypothetical protein
Phyra_79458predicted protein

Sequence
1710 bases(100 bases per row)
AAGCGCATCCGAGCCCAGAAGACAACGAAGGCGCTGCAGCAAAAGCTGGCCGACCTGGAAGGTAACAGCAGCAACTTGGGCAGTAGCGCGTTCGAGATGA
TGCTCCTCTTCCGTGAGAGGAATGAGCGAAAGGCGGAGGACCGCCGTGTCGAGGAAGACCTGCGTCGCCGCGACGAAGCTGCCGCGAAAGAGGTACGACT
CATCGTTGACAAGGTAGAGATGGAGGAGCGTCGCCGCCAGGATAAAATTGATATGGACGAGCGTCTGCGGCGTGATAAAGAGGACGCGCGCGCACCCAAG
AGCTGTTGTTGCTGATCGAGGCCGTCATGAAGAAAACCTAACCCGGGGCGAGCCAGTCGGTTGCACACGCAACATGTGCCCGGTGCGGGGCTACATTGGC
GCGTTCAAGGTTCCCACGATTCGCTGGGCTCACAATATCTGTCAACCACAAGCTGTGCGCAGATTTGGAGCTGAACCGATGCACCCTTGACCATCGAGTT
ACGTTCATGTTGTACCGTTCTATTAGCAAGTAATCTACGGAGCCTTCGAGCCTCTAAATACACAGCTATCCATAACCCTTCCGGACGCCCAACAAGAGAG
CAATATCCACGCTGCTTGTTGCATTTTAAACTTGGCTGCGCACCACGTATGCACTTAGCGTCACAGTCTAGTCAAACGTTGAGAAGACATCTCTATGTAC
AGCATCAAAACAAGATTATATGAAACTTCATTACGCAAATATACACACACACCGACGCTGTTGAAGGTGAAGGCACTACTCGCCCACACCGTCGCTGCAA
AGCCCATGTCGCCGTTGAATGTTGTACGGATCTGTGAGATCCCAACAGTACGCACCCGAAAGTTCGTCATCCGGAAGATATTGTTCAGCCGGCGACCGCA
ACGTCCTGGGTCGTACGGCAACGGGATGTTAAGGCGACTGTACACCTTCTGCATGCTGCCCATGCCCCACTCCGCAGCCTGGTGGACGGACGTGATCGCG
TTGTGAAGCGTCCTGGCGAAACTGCGTAGTGAAGGCACGAGCCGGTCGATATCCCCGTCCTTCAGCGGAGTCAATATCCGGCCTGTCATTGTTGTCGAAC
ATGGAAACGCCGAGTCAGAAACGACGTTCATCCGTGCGTCGGGGCACACAGCGGGGTCCAGCAGCTTCATGCGGAAGCCCAATGATGTGTCAGAATCATT
CCATGACCCTGGGCAAATTGTGCTTGCACCAGATGATGCAACCGTCCACTGCGAAGCAAATGGTGCCCGTCACGAAGACAGAGTGCAGCCACCCGTTGTA
CATCGCGTTCTGGAGGTCCGCGTTGGACGGTTGCATCACCTGCAACGCATTCACGCACTAGTTAGCCCCATAAACGACATCAATACAATCTTCCGCTCGA
CTTTTTTACCCGAAGATTCTTGAATAACCCAAACGTGTGCTGGAGCAGCGGCTCCCGGGATTCGACCAACTTGGCCAAGTTGGCCTGCTGCGCGGGCGAC
GGGAAAGAGATTCTGGCAGGGGCGTAACCTTGCAGCGCTCGATAGAGAGCAACCTCAGCCTTGCTCATCGTCCGAGACAGCGTCGCCAGTGGTAACCCGA
ACACCATGCACAGCGTGCTGTGCTCCATGCTGCCCACGTAGAAGCACAGAAGCAACCCCAGGACTTGATGTAGGTACCGGAGCTTGGGCGGTCTGCCTCT
CGCAGAAGGT