Description :
From Genome Similarity Track
Location :
Scaffold_331:2923- 4420
Transcript NameFunction/comments
Pytap_DAOMBR444fgenesh_masked-pag1_scaffold_331-abinit-gene-0.38Sodium/hydrogen exchanger
Pytap_DAOMBR444maker-pag1_scaffold_331-fgenesh-gene-0.5Conserved gene of unknown function

Sequence
1497 bases(100 bases per row)
ACAATCTGCGCCCACGCTACTACTGCAACCATCAGCCGCTGTTTCGCAGCTCCAGGAATCGCTCTCGAACAAATTCACGAAGGAGACTGATGACGACcGG
TACGAAAAACTCGACACGTTTGTGAAgAACCCCCCGACTCAGTTGAAAGGAGTTGTGAACGAGAGAGACATGCAAGAGGCATTGAGTGAGCTTTTCTTTA
GCGAACACGTCGAACAACGACAGCGGTtGCGACAACTTATAAACGGAATCGCAGCGCATGACACTGTTGGCACTCCCCGGTTGGATCCACTGGAATCAAT
GGCGGCACAgCTGGACGATTCTCTGAGTCGAACCAAACTTCGAAACGCAGTCGACCTTGCcAACGCAATGCTgCTCACGAAGAAACAGGAAAAACGGATG
ATGCAGATGCTAATCGACGCAGATGCACGGGCGATTGAACAAGAGCGTGCTGCACTCGAGCAAGCCCTTCATCGCCACCACTTAGACCGCATCGCTGCCA
ACGACTTTTCTGCTAATGAACAAGCGGGTCATGCGGCAGACCGCGAGTGGATAACGAAAGTGGCCAAACAAAAGACGGTAAGCCAAAGTTTCACACCGGC
ACTTGATAGCCTCTAAACTTGCTGTCACACAGCCTTCTCCATGGCAAGCTCGAAACTGGCGTGCGAAAGAAGCTCATCGACGTCAACTTGAAAAGGAACG
AGCGAGCGATGGAGATAGATTAGTAACGGAGCAGCGATGTGAAAATGAAAGTGGAGCCGACGACACTGAAGCAAGAGCCCATCGGGATAGCAAAGTGAAT
GGGTCTAGCAATCGGAAGCAGACCAAATTCCGAACACGAAGACCTCCATTACCAGAAACCAAAGCTAGCCAGCCAGTGTCAGTATCTCTCACGACACGCT
CGACGCCGAGCGTTCCACCGCCTTCAGGCTCAGCAACATCGCCTAAGATGACATTATCTAAGCAACCTGGCACTGTCTCCGACCGCTTCCGCACTATCGA
AACCGTGGAACAAGCAGCTCGAGATCAGCTGGATCACGTGCCGTCACGAGATCTTCTcgTACGCTGTGCGACGATTCGCCAACATGCAGACGAGCACATC
GAGGGACTATCTCACTACCGCGACCGATTCCACGAGAATGAAGCCGCTTGGGAAGCCATGCGCCAAGATCCCATCAATATCGTACGCCGCCACTTGCGCC
GCAAGCTTTACCAGGACGCTCAAGAGATCCAGATCGCAGGGACGCAGCTCTTCTACTCGTCGCTGTTCCAGTAACGGTATTCTCAAATAAACGAGCCGGA
TAATAGTCTATTCACTTGATGTACACCTCTTGAGCTGTTCAATCAGTTCgaTACATTTGTCCGCAaCAAAAACCACAAATCCACTCGGCTGCTTGACATG
CTTGGtCCcTTGGAACTCAAaGATACAGTCTTCAAGCGGCTCGGCCATAGCCATCTTCCACGACTCCATACCATCTTCCTCTTCATTCAGGTTGCTC