Description :
From Genome Similarity Track
Location :
scaffold_952:2923- 4277
Transcript NameFunction/comments
g10685.t1hypothetical protein

Sequence
1354 bases(100 bases per row)
TGAAAGCGCGTATGCAAGAGATGCAGACGCGAAGGGGCTGCTGGAGTACCTCGCAGCACCTTCTGACGCGGCGCGTCGGAAGCTAACCCCTCATCTTCGG
TCTCGTGTACATCGGTATCGTGCACACGAAGGGCTACTGCTGTACAGTGCAGTAGACGACAATGCGGTCCGCATTGTCGTCCCGAATGATCATGATCTAC
GATTGAGGATCATGTTTGAGTATCACGATGCCCTTACGGCAGAAGACATACACTCTTCTCACGCGTGACTTCTACTGGCACCACCAGTACAAGTGGGTGC
GCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGCGTGAAGCCTGCGCCGTTCTCGCAGGCTCCTCTTCAGTCACTTCCGACTCCGTCGGAGTGTTGGCA
GTCCATGTCCTTGGACTTTGTCTTCGGTCTTCCGCCTGACAGCAAGCCGAGGACGGGCATCGTTGTCTTTGTGGACCGATTCAGCAAGATGGTCCATCTT
GCTGCCGTCCCGACTACTGTTACAGCCGCGCAGACTGCGCGACTGTTTGTTGACATGGTGTTCAACCACCATGGCATGTCGCTCGATATTGTGTCGGACC
GTGATCCACGCTTCACAGCGCGGTTCTGGCAAGAAGTGTTTACACTTCTTGGTTCACAGTTGTCAATGTCGACTGCGGGTCATCCGCAGACGGACGGACA
GACCGAACGCGTCAACCGTGTACTGGGTGACGCGCTGAAGAGCTGCGCTCACTCGTTCCCGCATTGGAGCGAGTGCTTGCCGATGGCAGAGTTTGCCATC
AACAACTCGGTGCATGCCTCGACTGGGCAAACACCGTTCTACGTGGACGCCATGAGGCATCCACGTTTGCCGAGCATGTTCGGCGGGGTAGCTTCCTCCT
TAAGTGGGGGAGGATCTACGGTTTCGTCTTAACAACCGCAGAATACAGCTGATAGCACACTATCAGCTGCGGTGACGCGTGCAGCGTCTCGTTCGAGTAG
GAACGGACGTGCGATGTCTGTGCCGGGCTCATACATAGGGAGTGATGGCGCGCAGGCAGGGACTGCTGCGGACGAAGACGACGAGCTGAAAGGATTCAGC
TCGAACGCGCTAGACTTCGTCCAGCGAAGACAAGCCGTGATACGGTTTGTGCAAGACGCTATCGCAGCTTCTGTCGATCGACAGAAGCTGAACGCTGGTA
ATGTTGGCAGGGGCAACATGAATGAATTCAAAAAGGGTTCATTGGTTTTGTTAGCTACTCAAAACCTGCCTAAACATGCAGTGTCTGACTTTGGAGCAAG
CTTGCTCCAAGATTCATTGGATCGTTCACAATACTGGAACGGCACGGCAACGCG