Description :
From Genome Similarity Track
Location :
contig_2:292248- 295850
Transcript NameFunction/comments
g556.t1ETI51188.1 hypothetical protein F443_05389 [Phytophthora parasitica P1569

Sequence
3602 bases(100 bases per row)
GCGTTGGCTCGCGGACGAGATGGAGATCATGGAGACGCTGTCGCGGCGCGTGCGCCCCATCGACACGACGGCTAGCAAGCAGAAGCTGCGCGTGCTGGGC
GAGTTCTTCCCCTCGGTGGCCGTGGACGTGCGCCGCGATGTGCTGGTGGCTGCAAACTACCGCGAGGACGTGGCGGCGGCCATGCTGGGCGACCTCGCGC
AGGAGTCAGTGGCAGCGCGCGGACAGGAGCCTACGGAGCTGCTGTTCGTGAACCTGCACGCGGATGACGACGCCGCCTCGGAGCTGGCGGACGAGGAGGA
CTGGAGCGAGGTGCGGCTGCCAGTAGCAGCGGCACCGACGCTTGGGTCGTGATCCAGGACGACTGGGAGGTTGTCGACAAGGACGGCGAGAGAGTCCGCA
CTTTTGCCGACGTGCTTCAGACAACGGCCGTGCCGACGATGTCGGCGTGTCCGAAGCGACCGGCCCAGCTGTCGCGACTCTCCATCGTAGAGCACGCTCC
TGTACCCAGCAGCAGACGTTGAAGAAGGTGGAGGGTGACCCTGCGCTACCATTCTACGAGCTCGAGCGCGGCGTTAAGTCGTTCGGCGCACGGAAGCACC
ACCTGCTCCAACACCATCGGTAGACGCCAATGGGTTGAAGCGCGCGCTGGGGCGACAGCGGCAATGGCCCCAGAGTATTTTATTTTTTGGAATCGGCACT
CCACGGCGGTGATGGCCAGAGATGGCGACCGAGCGCTCACAAACACTAACAGCAACAGTAACGGGCGGTGCAGATGGCCTCTTCTCGCCACCCCCATCGG
AACAGCAGTACCATAAACTACCATAAAGAAGTCCCCCGAAATGGAAGCAGCCTATTGGGAAAATGAGCACGTACGATTGTAGTAATGCTGCTCGGCCGGT
CGGGTCGCCGCATTGGCGCCAGGATTCACGGACAACTGCAACCGGACGATGGTCGATTGATCGAGCCCGCAATCGCATTGCATCAACAATCCCACTGTTT
TCAGTGAAGGTAGAACACTGAGCTCTCGACTAAGTTTGGTTTACACCATGCTCTCTTAAATTCCTCGTCAACACTTAACTTAGACCAGTGTGGGCGGACA
CGTGAGTCGCGTAATACCGGTACACTGCATTCCCTACATGCACAGACAATGATTAAATATGTTTATGACGTTTCATGTCATATGACAGGTAAAACTAACA
GATAATGAGACGGCGCCAGAATATAGTTTTACAATTTTATAGAATTATGCATACGGTTAAATACAAAGTGAGCACGGTAGTCTGCTCTCTCAAGGCGTTT
CACACCGCTTCTTCCCCCCCTAGCCGATCATATAAATACCTGGCCGCTGGAGAGCGCTTGGCCATCGCTGGCATCTCTTATCTCCGCCTTGCTCTTCCGC
TGCCATGTTCAAGGTGTACGCAGAACGCGCGGAGCTGCTGCTGGAGGATTGCCGCGCGGGCGCCGGCCCGTGGCTGCGACTCACGGCGAATGCGTCGACG
AGCGGTGTGGACATCGAGCAGCTGGCCGCGCAGCCCAGCGAGGACGCCGCCACGGTGCCCATCCACGCTGTATACGGCGTGTACACGCTGCTTAGCGGCC
CGTACCTGGCGGTGGTCACGGATTCGCGCGTTGTGGGCTCAGGCCCGAACAGCGAGAAGATTTACTGCATCCTGGAGCTCACGCTGCTGCCCGTGAGCGC
CGCCGCCCACCAGAGCTTCTTCAAGCACGCAAGCAGTCGCGAGAAGCAGGACGAGCGCGAGTATTGTTGCATGCTCACGACGGCGTTGGCCTCGCGCACC
TTCTACTTCTCGTACGACCTGGACCTGACGCTGTCGGCCCAGAAGCGCGCGTCTGCCTCGGCCTCGTCGGCGGCGCAACGTCAGTCGCCGTTTTACGCGC
GGGCAGAGGAGGATTTCTTCTGGAACAAGCCTGTGCTGGGCCGCTTCATCGAGCTGGAGCTCAGCGACTGGATCGTGCCCGTCATCTCGGGCTTCGTGAA
GGTCATCAAGAAGTGCGACGTCAACGGCCAGCGCTGCGATATTTTATTCTTCACGAGAAGGAGCTGGAGACGGGTGGGTACGCGCTTCAACGTCAGGGGC
GTCGACAAGGACGGATGCGTCGCCAACTTCGCCGAGACGGAGATGCTGCTGGTCAAGCCGTCAAGGGCCGTGTGCTCGTACGTGCAGGTGCGGGGCAGCA
TCCCGCTGTACTGGGACCAAATGGTCACGTTGAAGTACATGCCTCGCACGCGCTACGCCTTCTCGGGCCACGAGAGCGTCGTGGACTGGAACGAGCTGGC
CTTCCGAGCGCACATGGACAACCTCATCCAGCGCTACGGTCATATCACGTGCGTGAACCTTATCGACAAGGCAGGCAAGAGTGCCACCGTGCGGGATCAG
GCGCAGCTCGGCTCGGCGTTCGGCAAATATGTCAAAAAGTATAACCTGCTGTCCAAGTCGGGAGATGGCACGAGCTCGGTGGGATCTGCACCGGCGTCTT
CGATGCCTGCTTCCCCTGCATTCCACAGCTTGTCACCCCGTCAGCACAAGAGCATGTCAATCTCCTTGCCCTCGGCGCCTGCATCCAATGGAAGCAACGG
GTTCAGCCTTTCGAACGGTGGAGGTTCTGCTGCAGGTTCGCCGACGAGTGCGTCAACAGCGAGCAGCGAGAAAGGCCCGGGTCTTCAGGTACCCCGACGT
TGCAGTCGTCAGTGTCGCTCCCCGTACGGGAGCAGCCACCACTCCAAGTGGCAGTGCCGTCGGCACCCACGTCGATTTCACAGCTCTTTGCCGAGCCTGT
TGCGTATGTATGGTTCGACTTTCACCACGAGTGTCGTAAAATGGCATGGCACAACCTTTCCAAGCTCTTGGCCGAGGTGGAGGAGCAATTCACGCAATAC
GGCTGGTTCGAGTGCGACGGCGAAGGACGACTAATCTCACGCCAGCGCGGTGTCTTCCGCGTAAACTGCATGGACAACTTAGATCGCACCAACGTCGTAA
TGAGTCTCTTTGCTCGGCGTACGATACTTATGGCGCTTCAGCTCTATCCGTTCAGTAGCGCTGGGAGCGACAAGGGCGATACTGTGCTGGATTCGCCCTA
TGGGAGCTTCGAGGTCGTGTTCAAGAATGCATGGGCAGACAACGCAGACTATGTGAGCAGGATGTACGCTGGCACTGGCGCACTGAAACGGACTTTACGC
GCACTGGACGGCGGAACAATTGCAGGTGCTCTGCAAGACGGCGTGAACTCGGTCACACGCTATTACCTCAACAATTTTTCAGACGGCGTTCGCCAGGACA
CGTTTGACCTGCTTGTCGGAAACTTCGCACCAGATAAGCGGGACGAGTCTCCGTTTACTTTTCAACAGCAGCACAGTCTCCTGAACATGATGCTGGAGGC
CACCCTCGCCGCGCTTGCGGTGATCAGTGTGTCTCTCAGTATGCGGCCAGACTTGCCTGTGGCCACACGAGTGCGCGACGGCCTCATCGCTACATTCGCG
CTATTTTCCGTAACGGGATACCTCATCCTCAAAAAGGGGAAGTTCCGTTCCATCGGGCGCCGATACGTTTGCAAGCCAGCGTTCTGCTCCAGCGGGTACA
TC