Description :
From Genome Similarity Track
Location :
contig_2:292241- 295843
Transcript NameFunction/comments
g614.t1hypothetical protein
g615.t1ETK91105.1 hypothetical protein L915_05246 [Phytophthora parasitica

Sequence
3602 bases(100 bases per row)
GCGTTGGCTCGCGGACGAGATGGAGATCATGGAGGCGCTGTCGCGGCGCGTGCGCCCCATCGACACGACGGCTAGCAAGCAGAAGCTGCGCGTGCTGGGC
GAGTTCTTCCCCTCGGTGGCCGTGGACGTGCGCCGCGATGTGCTGGTGGCTGCAAACTACCGCGAGGACGTGGCGGCGGCCATGCTGGGCGACCTCGCGC
AGGAGTCAGTGGCAGCGCGCGGACAGGAGCCTACGGAGCTGCTGTTCGTGAACCTGCACGCGGATGACGACGCCGCCTCGGAGCTGGCGGACGAGGAGGA
CTGGAGCGAGGTGCGGCTGCCAGCAGCAGCGGCACCGACGCTTGGGTCGTGATCCAGGACGACTGGGAGGTTGTCGACAAGGACGGCGAGAGAGTCCGCA
CTTTTGCCGACGTGCTTCAGACAGCGGCCGTGCCGACGATGTCGGCGTGTCCGAAGCGACCGGCCCAGCTGTCGCGACTCTCCATCGTAGAGCACGCTCC
TGTACCCAGCAGCAGACGTTGAAGAAGGTGGAGGGTGACCCTGCGCTACCATTCTACGAGCTCGAGCGCGGCGTTAAGTCGTTCGGCGCACGGAAGCGCC
ACCTGCTCCAACACCATCGGTAGACGCCAATGGGTTGAAGCGCGCGCTGGGGCGACAGCGGCAATGGCCCCAGAGTATTTTATTTTTTGGAATCGGCACT
CCACGGCGGTGATGGCCAGAGATGGCGACCGAGCGCTCACAAACACTAACAGCAACAGTAACGGGCGGTGCAGATGGCCTCTTCTCGCCACCCCCATCGG
AACAGCAGTACCATAAACTACCATAAAGAAGTCCCCCGAAATGGAAGCAGCCTATTGGGAAAATGAGCACGTACGATTGTAGTAATGCTGCTCGGCCGGT
CGGGTCGCCGCATTGGCGCCAGGATTCACGGACAACTGCAACCGGACGATGGTCGATTGATCGAGCCTGCAATCGCATTGCATCAACAGTCCCACTGTTT
TCAGTGAAGGTAGAACACTGAGCTCTCGACTAAGTTTGGTTTACACCATGCTCTCTTAAATTCCTCGTCAACACTTAACTTAGACCAGTGTGGGCGGACA
CGTGAGTCGCGTAATACCGGTACACTGCATTCCCTACATGCACAGACAATGATTAAATATGTTTATGAAGTTTCATGTCATATGACAGGTAAAACCAACA
GATAATGAGAAGGCGCCAGAATATAGTTTTACAATTTTATATAATTATGCATACGGTTAAATACAAAGTGAGCACGGTAGTCTGCTCTCTCAAGGCGTTT
CACACCGCTTCTTCCCCCCCTAGCCGATCATATAAATACCTGGCCGCTGGAGAGCGCTTGGCCATCGCTGGCATCTCTTATCTCCGCCTTGCTCTTCCGC
TGCCATGTTCAAGGTGTACGCAGAACGCGCGGAGCTGCTGCTGGAGGATTGCCGCGCGGGCGCCGGCCCGTGGCTGCGACTCACGGCGAATGCGTCGACG
AGCGGTGTGGACATCGAGCAGCTGGCCGCGCAGCCCAGCGAGGACGCCGCCACGGTGCCCATCCACGCTGTATACGGTGTGTACACGCTGCTTAGCGGCC
CGTACCTGGCGGTGGTCACGGATTCGCGCGTTGTGGGCTCAGGCCCGAACAGCGAGAAGATTTACTGCATCCTGGAGCTCACGCTGCTGCCCGTGAGCGC
CGCCGCCCACCAGAGCTTCTTCAAGCACGCAAGCAGTCGCGAGAAGCAGGACGAGCGCGAGTATTGTCGCATGCTCACGACGGCGTTGGCCTCGCGCACC
TTCTACTTCTCGTACGACCTGGACCTGACGCTGTCGGCCCAGAAGCGCGCGTCTGCCTCGGCCTCGTCGGCGGCGCAACGTCAGTCGCCGTTTTACGCGC
GGGCAGAGGAGGATTTCTTCTGGAACAAGCCCGTGCTGGGCCGCTTCATCGAGCTGGAGCTCAGCGACTGGATCGTGCCCGTCATCTCGGGCTTCGTGAA
GGTCATCAAGAAGTGCGACGTCAACGGCCAGCGCTGCGATATTTTATTCTTCACGAGAAGGAGCTGGAGACGGGTGGGTACGCGCTTCAACGTCAGGGGC
GTCGACAAGGACGGATGCGTCGCCAACTTCGCCGAGACGGAGATGCTGCTGGTCAAGCCGTCAAGGGCCGTGTGCTCGTACGTGCAGGTGCGGGGCAGCA
TCCCGCTGTACTGGGACCAAATGGTCACGTTGAAGTACATGCCTCGCACGCGCTACGCCTTCTCGGGCCACGAGAGCGTCGTGGACTGGAACGAGCTGGC
CTTCCGAGCGCACATGGACAACCTCATCCAGCGCTACGGTCATATCACGTGCGTGAACCTTATCGACAAGGCAGGCAAGAGTGCCACCGTGCGGGATCAG
GCGCAGCTCGGCTCGGCGTTCGGCAAATATGTCAAAAAGTATAACCTGCTGTCCAAGTCGGGAGATGGCACGAGCTCGGTGGGATCTGCACCGGCGTCTT
CGATGCCTGCTTCCCCTGCATTCCACAGCTTGTCACCCCGTCAACACAAGAGCATGTCAATCTCCTTGCCCTCGGCGCCTGCATCCAATGGAAGCAACGG
GTTCAGCCTTTCGAACGGTGGAGGTTCTGCTGCAGGTTCGCCGACGAGTGCGTCAACAGCGAGCAGCGAGAAAGGCCCGGGTCTTCAGGTACCCCGACGT
TGCAGTCGTCAGTGTCGCTCCCCGTACGGGAGCAGCCACCACTCCAAGTGGCAGTGCCGTCGGCACCCACGTCGATTTCACAGCTCTTTGCCGAGCCTGT
TGCGTATGTATGGTTCGACTTTCACCACGAGTATCGTAAAATGGCATGGCACAACCTTTCCAAGCTCTTGGCCGAGGTGGAGGAGCAATTCACGCAATAC
GGCTGGTTCGAGTGCGACGGCGAAGGACGACTAATCTCACGCCAGCGCGGTGTCTTCCGCGTAAACTGCATGGACAACTTAGATCGCACCAACGTCGTAA
TGAGTCTCTTTGCTCGGCGTACGATACTTATGGCGCTTCAGCTCTATCCGTTCAGTAGCGCTGGGAGCGACAAGGGCGATACTGTGCTGGATTCGCCCTA
TGGGAGCTTCGAGGTCGTGTTCAAGAACGCATGGGCAGACAACGCAGACTATGTGAGCAGGATGTACGCTGGCACTGGCGCACTGAAACGGACTTTACGC
GCACTGGACGGCGGAACAATTGCAGGTGCTCTGCAAGACGGCGTGAACTCGGTCACACGCTATTACCTCAACAATTTTTCAGACGGCGTTCGCCAGGACA
CGTTTGACCTGCTTGTCGGAAACTTCGCACCAGATAAGCGGGACGAGTCTCCGTTTACTTTTCAACAGCAGCACAGTCTCCTGAACATGATGCTGGAGGC
CACCCTCGCCGCGCTTGCGGTGATCAGTGTGTCTCTCAGTATGCGGCCAGACTTGCCTGTGGCCACACGAGTGCGCGACGGCCTCATCGCTACATTCGCG
CTATTTTCCGTAACGGGATACCTCATCCTCAAAAAGGGGAAGTTCCGTTCCATCGGGCGCCGATACGTTTGCAAGCCAGCGTTCTGCTCCAGCGGGTACA
TC