Description :
From Genome Similarity Track
Location :
Scaffold_928:2922- 9945
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_928-fgenesh-gene-0.2HEAT repeat-containing protein 5A
Pytve_DAOMBR484maker-pve_contig_928-fgenesh-gene-0.1Soluble NSF Attachment Protein (SNAP) Receptor (SNARE)

Sequence
7023 bases(100 bases per row)
GTTTGATCCTTCTGCAGCGCGACTTGCAGACGACCGAGGCCACGACCCGCATCCTTGCATCAGAATGCCGTACGCATATGTCGCGTCCGTCCAGCAGTTC
GCAATGTACTCGGCGTGATCCGAGATAGCGTTGATCAGCGTCTTGGTTAACGAGGAAGGTCCCATGGCGCGAACATTATCGCTCGCCGGTCCGTCCACTG
AGATCGCAGCGACGAGCATGCCAGCCACAGTTGAGAGGTTCGCGAGCGCGAGGTTCGTCCGGGTCACATCGTCGCCCACAAAGTGGCGGTGGCCATAGTC
GCTGGTGATCACCATCTTCAAGATTCGATTGAGCGCCACCTTGTCTTGGACTAGTCGCGCGGAAATGCAGTTTGCGCACACGGCGTGAGCCTCGATCAGC
AGCGGTGCGTAAAACTCGCGCCGCGACGTCGAGCTCCCGTCTTTCCCGTCGTCAACATGGGTTTGTTTCAGCGCGTGGCGAAGCGCTGCCGACAATTGCG
CTTGATACGGGTCCAGTAGCAAGGCGTCGCCAATCGCAACCTCTGGATCCCGTGCTGCTCCAAACCGCTTCAAGAGAACGTTCAGCAATTGCAGTCCTGA
ACTCTGAAACATTTGAAGCTCGCTCGTATCGGCAGACGACGTCGAGACGTGGCAGGCCAAAGTCACAAACTCGTCCAGGTACATACAAAGGAAGTTGGAT
GCGCTGTCGGACGCTTGGCGACCACCAATCGATGCACTGTTCAGTATCTCCGCCTTGAGTTTGTCCAGATAGTACCCACGCGTGGCTACCAAATCAAAAT
GCAGGTTCGCCGCGACCGGGGAGCCAGATTCTGCCAGTTCAAACACGCGCAAGACTGCCTCGACAGCGAAATGACGCACTTGACGCGAAAGCGGGGGAAG
CAGCGCCACCATCTCGCTCACGCTCTTTTTGGTCGCTCGCCACGTCTCGACTTGAGCAGCGATGGATGCTGAGGCGAGCAATGTGTCGTCATGAGTATCC
ACAGCCGCTGCCGTTGACTGCGGCCACGATGTTGAGTCACGTCCCGCTGCTCCATCGGCGCTGGCTGACAATGAACTGATGGCGTCGGCTCCTTTCGGAC
TCATCATCAACTGCTCGTCGTCAGTCTCGCCAGAAAAGTTGTTCGACGATTCACCGATTGCGATGCTTCGACACAGCAAAGCCCACACACAAGGCTGAGC
ATCCGCTCGGTTTCCGCCGTCAATCTCCAGCAGAGCGAGGATGGTGCCGCGAATATCGTCAACGCTATTCCGTGCCGGCGGCAGCAGGCTCACGCACTTG
AACGTCAGCACATCCCACATGCCGTGCAGTCTCGGCAAATACCGCCACATCACATCATTGAACTCCACATGAAGCGCGGCGAACAGCAGGCAATGCAGAT
TGTTGCCTTGAATCAGCGCCGGCTCACGCTCGACCACAGTGCGGACGCATGACAGAGCCACTTTCTGCAAGAGCGCTCGACTGATGCCATTCGCGTCGGG
TCCACTGCAGCCCGACATCCAAAACCCAGCGGGGATGTCCAATGTCGTATCCGATGAACTCCTCCCAAGAGCAGGAAACGACGGCGACGAAATGACCGCC
AGCTCCGACACAATGGTCAATACGTGGCGGAAATCAGCAGTCCGGAACTTAGCAGGCGCCAGCACTGCAACTTGTTCAAGAAACTTGACGTATTGCAGCT
CCACATTCGCGTCGTGCTCTTGGCGCAGCAGTTCCCAAATCGCGAACAGCTCGCTTAATCGCTCACCCGAAGCCCCAAGTTCTGGACCCACAGTAGCGAC
CATCCCGTTGATGATCCGCCCAATTGCGGTCTTTGCGCTGCTTTGCCATCGCAGACCCTTCTTGTTCGCTTTAGAGTACCTGAAGCCGGCCAACAACTGT
GCCTCCATGACTGCAAACGTAGACGTGATAAACTGGTCATAGTCTTCGCCTGCAGTGTTCACTGTCTCCATGATGATACTCCACGCATGCAGGATCCACG
TGCGCAGTGGCTGCGTTGCCTCGCCAGCGAAACGATAGATCAGCTTTGAGTCGATAGAGATCATCGACCCACACGCTCGCTTAATGCACGCCAGAGCAAA
CGCAGCTCCGGCAAACAGGACTGTGGGGTCCGGTTCGGGGGTTCCATTCGTGGTGAACGCCGATGTTGTCGTGTTGGATGCTGGCAATTTGTCGGCGACC
AGCCGCTTCTCGATATCAATCACCAGTCCTCGTCGAGGGTCTTGGGGAAGTACCGCAGCAAGTATGCCAATAGCCTCGCCAGCTCCGCGACGCACCTTGC
TATTCTCGCTTCCAATCATTTCACACAGCATTGTTTGCACCTGCGACGGCCACCCCGCAGTTGCCAGAGACAGCGACGCGGACGATCCGGATAATGGAGA
CGACGCGGCACTTGACAGACTCGCCTCTCGGACTATCGCGAAGAGCAGCGAGCACACGTTGATCTCGCAGCTTACCCGGTCATCTGCAAGGATGCCAGCG
AAATGCTGGAGGCACCGCAGTTGGAGGTCTTCAGGAAGGAAATGGAAGAGACGTCCAAACAAATACACGCACACATCCACGAGGCGCACGTAGGTCGAGC
TGCTGCATATCCCCCGCTCATACGCATCAGTTGATGCATCATCCTCAAAAACGGCGGCCCAAAAGTTGTCAAGGTACTGGACTTCGACTTCTGTGTCCGA
CAGCAGGTTGTCTGGCTGCTGCAGTCCCAGTGAAAGGTTGGTCTCTCGCGAGTATAGTGGACACGATTGATCCCCCGGCACAAGTCTCGACGAGCTGACT
TGCTCCAGCAGGTCGTCGTTGGACGACAGCACCATGTGCAAAAATGTCGACTCGGCGGGAACAAGAGATGACTGGCGTAGACTTGTCAGGGCTTGTGCAG
TCGTATGTTCTGCAATCAGGTCTAGCAACAAAATGTACGAATCGCTGTACATAGGAGGTAGCATCGTGAAGCACTTGATCACCCACGAGATCACACGGTA
CCGAGCGACTTGACCACGTCTCTTGCGCGGGTTACTCAACGGATCATGCAGTGCCGATAGGTAGACTTGCAGCACGTGGTTCGCCAGCAAGTGGACATCG
TCCGATTCAGCCGCAATGGACTGACAAGAGCCGAGAAAGCCAGAGAGAGCCACTACCGCGGCCTCGATACGCAGTAGTTCCAACGAGGACTCGCGGTTGT
GCAGCACGCTCGACCTCAGCCACAGATCCAGCAGCTTTTGCAGATTCGTCCTTGTCCAGCGATCGTCATTAAACGCGGTGAGACTGCTGATCAGTGACCA
TCCTGCTCGGGTACACGTGAGCCAAATGCTATCAGGACACGCTTCCAGAAACTGACTCTCCACCAACTCTTCAGCCGCTGTCAGGATCTTGGTCAGCACT
TCATGGCTCAATCCACTCTTCTTCTGCACAGTGATGGCGCGAAGAATGTGCGTGACAGCTGTCGAACGACCCTGGATAGCATACAGATGGATTTTGCTCT
GCAGGTCGGGTTGTTCGATCTGGGAGTTGTCGTCGTTTGCCACATCGCTGACCCTCACCGCCGATTGAGATGAGTGTGGTTGCTCTTGAATGAGAAGCAT
CGCCGTATTGTGAAGTTCATCCAAGCACTCCAGTAACACGCACTTGAGATGGTACGGAAGAGCAGTCACCAAAGACGCCAAAGCCACCGCCGCCTGGAAC
CGTACGCTCTGCTTCTCATGGCACAGCAACCCTTGAAGGACACTGCTGCTCTCTTCTGCATGGCCAACAGCAGCCTCGCCCATTGCGTGGTAGCTATGGC
TCATCTCCACCAGAATTGACAGCACCTTGTGGTGATTCGCATCCGCCGACGCGCCGTCCTCCTTCAGTTTCTGCAAATAAATACCGAGGATTGTGTCTTG
CTGCCGCTCCGTCAATGTCAAAAACAACCCATTCCGAAGCACAAAGCTCACGGCGTTCCGAGCACGCGCGAGATCACTGAGCGAGAATGGATGGTCCAGA
ATGAGCAGTATCGCCTCGAGCACCTCCTGAATCTGTGTATCCGCAACGGAATCCGGTGGGAGTCTTCGGAACATGCCGCACAGCGCAATCGCGAAAGACG
ACAGGATGCCCCCGTTCCCTTGAGACGGGACTGGCGAGAGGTGCTTGGTGATGATCATGTCCTTGAAGTATTGGATGACGCTCGCAATGGTGGAAAAGTT
GACGGCTGCGGCCTTGCGACGAGACAAATTGATCGCCGCCATGCCCGGCACATGCATGCCCTTCAGCTTGAACGGGAGTTTCGATTTGGATCCTGGCGCA
GAACCAGATCCTGAACTTGTAGTACTATCGCCGTCGGAACTCGGACGAGGTGCGTCATCATCATCTGGCCCTCTGCTCGAACCCATAGCCTCGCCGTTCG
ACTGCAAGTCGCCTTCACCAGCCGACGAGGTCGCAAATTTTGCAAGAACGAGTCCAACCACCCCGGCGTACTCGCGCCTCGCCTCCACCGACAAATCGTC
CATACCTTTCGTCGCCACCTGCAAGATCGCCTCCAACGTCACTCCGTGGCCGTGCGGGTGTGCACCTCCACCGCTTCCTGAGCCACCTCCTGACGAAGAG
GCACCACCCATCGAGCCTGAACCGCCTGTTGAACCAGACCCTCCACCGCCACCACTTCCGGAAGAACCGCTAGAAGAGGATGTCGCTGCATTCGACGGCG
TTGTGTTGGCTGCGATGACGTTCAAGAGCCTGGCGGCGGCGATTCGGACCTCAGGAGCCTTGTCCTGGAACACCTTGGCCACAATCTTGAGCGCATCGCC
GTGGAAAGCCAACAGTCTCGGCAGGTCGCTAGCCAGAACGATCGCGACGCTCTCTAGCAGGCTCTGCTTGATGTAGTAGTCGGCCGCGCGAATGGTCTTG
TTGGTGAACGCAACCACCTCTGGGATGAACTGCAGCGCGTCCTGCAGCGGCAGGCGACACACCACCTTGACCAGCGATGCCTTCACGTACACCGTCGTGG
TCTTGGCCGCCAGTCCGTCGTTGATCACAGGCACGACCGAGAAGTCGAACGCGCGCACGAGCAGGTCGCAGATCAGCTGGTGCACGCACTCGGATGTCGG
GACGGTCGGCGCCGTCAGCGCCATCGACAGGTTGGTCGTCGCGCCGCTCGCGCCATTCCCCGACGTCCCCGTGTGCGTACCGCTGTACACGACGAGCGTC
TGGAACAGCAGCTGGAAGAGCTGCGGGTGGGTCTTGGGCTTCTTTTTCGCGGATCCGTCGCTTTGGCCGGCGCCCTCGCGTCGCCCACTTGCATGGAGAA
GCTCGGGCTTCCAGAGCCGCCGCACCGCGAACAGCTCCTTCAGCAGCTTCTTGTGCAGCTGCTGCTGGTCCACCGCGCTCCCGGCGGAGCGCAGCGACTC
CACGCAGGCGGCCAGGCGCCGCTGTGCGCTCTTCATTGCGGCGCTCGTGTTTCCCCTGTCGGAAGTGCGGTAAATGCCCCTCACAAACGCGACAAGAGTG
ATGATCGTCGGGGCATGACACCTGGCGGAGTCAGCGGGCCGGGTATGGGATCTTCAGAGTCGGCGGGTCGCGACCCGCGTTTTGTTGAAGCTGGATCCAC
TGCGTCAAAAGATGTCAACAAAGACCCAAGTCGGGTCAAAACCCATATTGAAAACCCGACCCACCCGTTTGCCTTATTTTGGAAACTCTGCTGCTGCATT
CTTCACGTGTTTCGAGCGACCACCATGATGCTGCAGTCGTCGCACTCGTGGGACGAGCTGCGGCGCAACGCGCGGGCCGCCGAGCGCCACCTGGAGGACA
AGATCGCGGCGTACACGTCGATCAGCAGGGCGGCGACGCGCAGCTCCAAGGTCTTCGACGAGGGTGAGCGGCAGCGCGTGCAGTACTTTGACGGCTCGGC
CAACGGACTCATTGTTTGGGATGGGGTTTCCACTCAGAGAACCCGCCTGAGGAGAGCACGAACGAGCGGGAGCTGGCGCTCGACATTGAAAACACGCTGA
CGACGGTATGGTTACATTCGTGTTGGTCTGTGTGTGGAGGGTGGCATCAGTAACGCGTGCAATCTGATGTAGCTGTCGGACACGATCGACGAGATGAGCT
CGTTCGTCAGCACGTCGTCGGTCAAGACGCAGGACGCGTTGCTGCAGCGGTACCGCGAGCTGTATTTCGACTTTAAGACGGAGTTTCGCCGCTCCTCGGT
GCGTTGGACGTCGAGAGGATGGAAGCGATCTGAAGACTGACATCCTTTTGATGCTTTCATTGTGTACACCAGAGCGCATTGCAGGAGAAGCGCGATGCGC
AGAAGCTGTTCGGCAACAGGTAGCGTTCGAGCCGTGTTCGGGCCGATGTCGATGCGATTGCGTGTTTGACGATGGAGCTGATCGAATGCCAGGCAGCAGG
ATGGGCTCGCGCAGGATGCCGAGGTCGACTCGCTGCTGAACGAACGGCGTGCCGTCGACTCGTCTCGCTCCATGACGAGCAGCATTATCGCGTCAGCCGA
TGTTTTTTCTTTTTTGCCACGATGGCGCAGGACACAATGAGACTCACGTGCTGTATGTGGCATGATGTTGCTGAAACAGCCAAGCTCTGGAGACCAAGAA
CGCGCTGGAGAACCAGCGCGCGCGGTTCACGTCGTCGCACGGCAAGGTCAACACGCTCGGGAACTCGTTCGCGGGGATCAACTCGCTCGTGGAGCAGATC
CGGCGCAAGAAGATGCGCAACAACACCATCCTCGCGCTCGTGATCGCCGCGTGCGTCTGCTTCACCCTCTGGTGGACGGTGCTTTCCAAGATTTAAGTGA
TCCATGGCAATTATTTCCTCTCTACTTTGGAGTCCTAGACAAGCAGAGCCTGGTGCGGACTAATAACAGCGTTGGGACTCTAGAGCAGACCCCTTAGCAC
AGCTCGACGCCAGAGTGATTTGTTACATCCCATTCTGACAGACACCATCGCGGCTTTGATGCTGCGACAGCCAGATTCCCGTGTGAATTAGAACATGTAG
TTATATCAGCTGTAACCGGTCGG