Description :
From Genome Similarity Track
Location :
Scaffold_3:292181- 300538
Sequence
8357 bases(100 bases per row)
CGCCCGTGTAGTTTCAGCAGGTAGGCTGGTTCGCAAAGTCGTCCGCGGATTACGAGCGGTTTGATGGAGACCACAGCCAAGTACTCTGGGAGTCGACCCA
CTGTTTGTGGATCTCTAAAGAGCAAGCGCGCACGAACTCGTTTCTCGCGTCGTATTACAACTCTCGGAAGAAGCGTCGGGGTCGAGCGGTCCAGGCGTGT
CGGGACGTGATAGGTTTTACCTTTCAGGGGATGAGTCTTGGTCGATGAGATCTTGACGTCCTCTTGGACCCCTTCTTTCGCCATCTCCCTCGACCTCGCT
GTGTGATGTATTGGTTTCCAGGGCGTGAGGAGGGGTCCAACCCGGTCAAACTGATCGAAGACCTCAGGATCTCCAACTCGGCGTTTCCATGTCACACGCA
GTACCGACTGTCCTCGGAACCGCATCCAGGCACCTTGGTTCCTCACATCCAGAACAAGTTTGTTCCACCCCTTCAGATTTGATAACTTGAATATACTTGT
TTCCTATTCGCTCTTGTCATTACATCTTCGTGCCTCGGTTTATTTGACCAAGGCTCGGCTTCGAAACTCCGGTCGACCTCTGAGGACCGCGGTCCCACAT
GAGAGACCGTGATCCATCATAAGAGACCAAGTCCACCCATGAGGGACCACGGTTCACCATAAGAGATTAGATCCACCTATGATGGACAGGGGTCCACCCC
TAGGACTTTCGAAAATACAGCTCTATTTTCGTGACTCTGCATAGCTTCGAACCGATTATGGCTCGTCTGCTTGCGCTCAAACTCTCGAAGGAGTGCTCCA
CAATTCGAATCAAGTTCATCCACCCAGGTGGAGTCTTTGTACCCCTTCCAACGAACGAGAAACTCTCGTTGCTGTCGCCCATACCGTGTTTTCTTACCAG
TGCGGCTCTCTAAAATTTCCTCGGCCTCTTATTTACCCTCTTCCAATTCTCGTACCCAACTGTCTTCCGGCAGTAGGCATTCGTCAAAATCAACCTGCTC
TGCTTGGTCCACTGCTAACTCGTTGTCTGGTCGATCAGGGAATTTCCTGACCCGCTTGAGTTTGGATATGTGTACAATCGGGAACAAACGGTATCCCGTT
CCCTGGGTTTCCAGACGTGCGACATGGTCTCCTACCAACTCCAGAACGCGGAAAGGTCCGTGCCAAAGATGAGCTAATTTCCTGGCATATCCTTCTTTTA
CTCGGTCGAGATAGGACCATACTTGGATTCCCTGTCGAATCTTGTGGTTGACCACCCCTTCGTTCTGCAATTGCACTCGCATCTGACTCGCATCTCGCAA
CTTCTCCTGTCTCTTGCTCGCTGGTACTGGCTTTGAATGCGGTGCCTCCACCTTCCGGGTTCTGACTCCTGACGCCGGACGTTCATTATCGGTAGTGTGG
CTTCAAAGGTGGATCTGGCATCCCAACCGTGGACCAAATAAAAAGGCGTTTCTTTTCGTACCCGGTCCTGTGAGGTATTGATCGCAAACGTCAATCTCTC
TGCGTACTCGTCTCAGTCCCGTTGCCCTACGTCCGCAATATACTACTTGATAGATCTGGTAAGAGTCTGGACCATCCTTTCCGCCGTACCATTAGCTTGG
GGTCGGTAGGCCATTGTCGCTAATTGACGTTGAACCACCATACTGTAAAACGCTCGGAAGAAGTCCAACATGAATCCCGGTTCTCGATCGTGACGGGTCG
CCTCACTAGCCCCAAAACGACGGAAAACACACCCTTCATATCCTTCAGCGACAGCCTGAGCTGCCCGCGACTCGCTAGCCTTGGTCATTACATATCCGGT
GAAAAAGTCAACCCATATCAGAAGTTCCGTATTTCCTTTATACGACTTAATCAGGGACGGGATATGGTCCATCTTTATAACTTGGAAAGGATGAGTCGCT
TCGATGTTCCCATGGCTCTTCCCTTTTAGGATAGATCCCCCTTTTTCAGTCTCACATCCCATGCAAAAACCAACGTATCTCTATGCACTCCAAAACAGAC
CTTTGTTAGTGACAGTAACGTCGTATGCGTTGGTATGTAGGCCCGATTTCTTGATGAACTCCTTCTAAACTAGTATGGTAGTGGTGGAGGAAGTCGGTCT
GGAGGCTTTCCGGTATCACCAGTCGGACCGTTATGTCACGGTCTTCTCCCTTGACCCTAGGGTTTGAACAATATACCAGCAATCTTTCCTCGCTTACATC
GCAATCCCCGTACATTTTGCCGCACTTTTTAGCGGATTTCACCAACAGGTCATTCCAGTCTCCTTTCAGATATGCATTCAAATCTCGTACCCAGATCTCC
TCTTCTTTCGCCTTTCTAATTCGGTCCACGCGGAGTCGCTGTACTACCTCCTCTTGCATGATCTCTCCGGATATCCTAATAGGAGACCGTGACCGAATTA
CCGCAAATATTTTGGTCGAGAGGTTCTGGTCTTTAAGAATTAGCAGCTCCGGTAGACGATTGATCGCTTCCAAACCTGGTCTTTCTTCGCCCGGTACCGA
ACTGGTTCCCCCTTTTTGTTGCAAGGCGGTACTAGCTAACTGATCTGCGCTCTGGTTCCTATCTCGTTTCACATGCAGGATTCCGTGCAAAGGCCACGAT
TAGAGTTCGTTTAAAGCCCGGGCTCGTAGCGGTGATATACCCGAGGCCTTACATTAAATTTCACCTCGCATCTGCCGCACTACTAAGTTGGAATCAATCG
TCGCCGCTCCAAAGGTTTCAACAAGCTAATATTAGCAACATACCCTCATATTCCGCCTCATTTACAGTAGATGTATCGATATATTTGGAGGCGGCTTCGA
CTATGGTCCAATTCGAAAGTCTCCATACGATAGAGCTACAAGCCCCACCTCCTTGCTTGACACGGACTGACCCATCGAAACTCATTACGTATAGTTCTTC
GTCTGATTCCACGGTAGGGGTGGGTAGGTCGATTGTTTGCCTCTCCTGCTTCTCTTAGGAGAAATTGCCGACAGTATTGAGTCTATACTCTCTCGAGGGG
TGACACTGGCTGCCAACGCCCCCAGCACCTGATCTTCACCTTTTTACACTTCACGATCTCCAAAGTACACTGAGACAAGTGAGCGGGCCAGTTTCCCAAT
CTCCCCTGCAAGCCGGTAGACTTTACCGACCATGCAATGTCGAGTGTCTTGTCAAGACTTTGAGAGGCCGAGTGACTAGCATAGTGAAACAGGTCTCCAG
TATACGCAATAGGGTCAATACCTCATTCTCCACTGTACTGTAATTTAGTTCGTTAGCCTTGAGGGTTCTGCGTGTAAAGGTTACCGGCATAAGCCGTCCT
TTATAATTCTGTACCAGTGACGCCGAAATGGCCCATTCACTCGCATAGACAATAATCACGGCTTCTCTGGTTGGGTCGAAGTGTCTCAGAATTGGCGCCG
TGGAAATTTTATTCTTGAGCATGGCAAAGGCTACTTGAACGCGGGCCCGCCTTTCTTTATTGTCATCCTGGAAATTGGTATTATTATGTCCCTTCAACTG
GTTTCGTCGGGTATGAAAGTCTACTTCTCCCAATTCATAGAGGATAGATGCATACACGGCGTAGTCCTCAATAAACCTGCTATATTAATTCAAGCTTTCC
AGGAAAGATTTCATGGCGTTCAGTGTCATTGGTAGGGGTAGGTCGACCAGAGATTAGAGGTCTTTCGGGTGAGCCTCTAGTCCTCCCTGGATACCCGATG
TCCAAGGTAGTCTACCGTTCGACATCCCCACGAGCTCTTGACTGCGTTGATTATTAAATTTCGGTAGTCGTACACATCTAACAACCATTCCACCTCTGTG
CATAACGCATCCCACGATTCTGCGGGGATCAGAACGTCATATATATATGACCGCCGGCCCAGGATCGAGGGAATCGACTACTCATCTGCTCTCCCACCTT
GAACAAATTATCGGACCCATCTGTATCCGTTTCTGGAGGGATTCGTAAAACCCCGTATAAAGCGTTACCCACGAGTCGTTGATATATTTGAGGCGCGTTC
TTGAGCCCAAACGGCATTCGCATCCATTCAAACAAACCCAGTGGGGTAATGAACGCCGAAATTCGTTTCGCCCTTTCAGTCATACCGACCACCCATAAAT
CCTCGCCATATTCAATGAGAAATACCATAATGCCTTGTCGAAATCTTCCAGTAATTCATTAATCAGAGGCATGGGGTAGACCATTAGCTGAGTCAGGTCG
TTCACCAACCTGTAGTCGATAGCATAGTAATAACGATTGGGATGGCCCAAGGTGACGTAGAAGGCTGTATAATCTTTGTAGATAACAGTCTTTGATCAGA
TCTGCCAACTTCTCCTTAAATTGGGGAGCCACTTTGCGTACGCTTTGCGTGATCGGCTTTGCATTTCCTACATCAATGTCACATATAGCCCCTCGAGCTG
CTGGCGGTTAGGCATTCCCTTTTTCCATCAACAGATGTCGTCTATTCCAAATGATTTGTCGTAGCCAGTCCACCTCTTCTGGAGTGTTCCCATCCGGATC
AGGGATCTGTATATATTTCAACTCAATAGATTCGGAGGAGGGGTCCACTTCTGGTATGATTGCCCACCCTTGGTTTATGTCTTCGGCCCACAGGTCTCCG
CTTTCGAATGTACGCACTTGTTCGTCGTCACGTGGCGACTTGTTGGTCTCGGCTTCCTCTGCCTCGACTGAGATTGCTCCCGATGGATCGTATTTGTGGT
CACTTCGTACTTGAGGGGTCTCTTCTTTGCGTGACTATTCTTCTCTCGGGTAGCCGCTGGTGTGACACGTTCTTCATTGAGACGTTTTGACCGCTTCGAG
AGCCTACCGAGACGAAACCTCGTGCTCTTGGTACTTGATCCTTCGTCAGCCACATACCTATCTTGGTATAATCATGTAATATCAGCGTGTAAGGGCTAAC
GTTGGTCACCTTCAGCAATTGTCGACGTCCTTTTCCCCGGGCCATAGTCGTAACCCATCGCTCTCCTCTTGTGACCCATATCCTCCGTAGATCTGAGATC
GACCTTTAAGGGGTACCTCCACAATCCACCGGCAAGTATACGGGCATATTGTTCCAACTTCACGTCCGCGACTCGGTTATCGTAAACGGTCCTTCGTCCG
GAGAGTTGTATCCGGACTTCGTTAGGGAGACAGAGTGTTCCATCCGCCAGATCTAGCCGGATCCCAGCCGGGACCATAAATCCATTCCAAAGATTGCATC
CTGACCCACCATAGGGCCTACCCACACCTTGAACACATTCACTAAATTTACATTTAGGGTGACCTTGATGGGAGTACGCCCTTCCGTAGAGTACACCGAT
TCCCCGAAGCCATGGCACTTTTGTCGTTCGCTTTCATCGATTTGGCAGCCTACCTTACATGCAAAGGCGACATCCAAAATGGATATCTCGGCGCCAGTAT
CGAACAACAAATTTGCGCGATCGTTGTTAATCTTCCCAGAGGCTTTGGCTTGTTTAAAACACTTAGTTGTGGCGTGGTATATCCAGTATCCTCGGGACTG
TCCAGGCAATAGGTCTAACTCCATCACTGCATTTTCCCGGGCGAAATCATTAGGTTCATTGAGAGAGACAACATGGACCATGGGATATTTTCGAATCTTC
GATACATTATCGGTCTTCTCAATGGAAACCCCCCTCTCCTTCTCGGGCTGCTTTTCCACATATGCAAAGATACAAAAACTAGATCGCTCGACTCGTACCA
GATTCAAACTTGGCGAGCGTTCTAATTTACCATCTTCTCCGCTTTCTCGGGCAACATTCCGGCGTGCTTGATGGGGTTGTAACATTGACGAATCAAATTG
TAGAAGTCCTCTAGGTGGCACTTCCCCGCTTCATGAGTCTCTCCGCACCCCCCACACACGAACAAGCAGCGATCCGATGGATGTCCCTTCTTTCCGCAGT
GGTCACAGGTCATTCATTCTCTTCCAGTATCTCAAGTCTCCATGTTTCCTGGACCCACAGTGGGTGCATCGTACGTTTGACTCGGCCGACGCGTTGCGGG
TTCCAGGGTCTTCTGATTGTTTCTGATGTTGGTCGACCTCTCTTGGGGGCCGATCCCTCGCGGTTTTTGGACTTGGGTCCCTTTCCGCTTCTGCTAAGTA
GATCCGTCTCAGTTCTCCCTCGTTATCCGAATTATTCAGGCTTGATCCCTCCTAACTCGACTTTTCTAGTGTCGCTCAGACTGCATGCACAGAACGGCGG
TTTACATATCTAGGTCGATCTGGAGGTGCAGGTACCTTCTACCGGAACTTGCTGGAACTAAATAGCGTCTTGCCACGCCGTGCGTTAGTCTTCTAGCGCG
CCTTTAATACTTCCTTCAATTCTTCCACGTCTGCCAGGAGTGGCATCGTCAATCGATCTGCCAGCTATGGGTCTTCTACGGTCTCGATGTAATGCTCGAC
GTGTTCCTTCTGGAGCTTGGGTGATCCATTTTTGATCTTCAGCTTCACCCTAAATGCAATCACATTCAGGCGGTATAGGTAGTCCAACGGGGATTCGTCT
GACCTCTTATTCGCGTGGTAGTACAGACGGGCAACTGGTACCCCCAGACCACAAAACTGCATCTGAAATTCTTGTAGCAGGTCCTTCCAATTTTATCTAA
TGGAGCGGCCCAATTGGCGGTGCCAGTTCTGCGCCAGCCGATGATCAGCAGTCCTCCGAAGACCAGAAACTTTTCGCTGTCTGGTGCTTGGTCCCTTCCG
AGGCTGGCTTCACTGTGTTTACCCAACCGAGAGCTCGGTCCTCGTCCAGGTCTCTTTGAGGTCCAAAGTTGTAGAGAGCCTGATGAGAGGAGCCATGCTG
AGTCCCTGTCCCATCGTATTATTTTCCATCCTCGCCGGAGTTTCCTCCAGGTCCAGATCATCCGGGTCTTATTTGCACGAGCCGACCGATTCCATGTCGA
CGTCCGACATTGTGGGTTGTCTTTGGGCTTGGACCTCTTCCCTCAGACCATTTCTAATAGTCGCCGGTCGTTCTTCCTGTCTCTCTCCGGCCTCTTCTCG
ATTAGGGCTTGTTGATGGCGCTTCCCTCCAGCATCTTTGACACGTGGCGGTGCTAAGGTTTTGGGATGATTTGGTAGGTTCGTTATTGGGCGAATTGTGG
CCTATCAGGAGTCCGCATTTCCGTTGGCTTTCAACACGTCGCCCCGTCGTAAGTAGGCTGTTCCGCCGGCGTATCTCGCGCGCGGGCCTGAAGTAACGCG
GCTCCGGTAGGCCCCAGTGACATTCAGGCGACGTGGCTGGACGTTGAGGATCGTTGTGACGAGTACCCTGCTGAGACTTGGGAACATGAAGACTGTGTTC
CGCGAGATGGTGGTTCAGTCGATCGTGGGTCCCAGTTCACTGCTTTTATTGGGGAGTGAACCTCAATATCCTGGAGATCCATTTGACTGTTTCTATTAGG
TTCGTACAAGTCTGCGACTGGAGACAAGGTGGGTCCCGTGGGGTGTATCCCGACAAGAATCCCCAAACATTTGTGCAGTTTTCCTAACGTTGTAGTGATG
CTGTCGAACCCCAGGGCAAACACGTCGTTCGGTTCGAACCTCTCTGCGGTCATGCCTGCTTCTCGAAGGAGAGTCACTAGCGCGGTAATTGCGTCTGTGA
TCGTCCGTATATATGGAAGGGGCGACAGTGGTCCTCACAGCTGTCCAAGTAGCCGGATCTCGAGAGATGTCGTCACCGGGTCGGTGGTCAGGAACGTGTC
GAACTTACATCGGTGGTAGGCCACCGTTATGTCAGCGTCCGACCAGATTAAGGGCTCTGAGCGTTCAGGGTAGGCAGTCTTGGTGTCTGGACTTGATTGG
TCCAGGACCAGCCGACTTGGTATTGCCGGGGGCCTTCATTTTGAACTTTTTCGTATTGGACGTTGCGATTGTTGTTGTTTTTTGTTGTTGTTTCGGGGAC
TTTAGCATCTCGACTTTGCCGTCTGCTGTTGGACCTCTGGGGCATGATAGGTATCATGACCCAAGGTGTCCTCTACGAGGACAAACGGAGGGTATTTAGT
TTTCTAATAGATAAGTTCGACCCTGACCTTGTTGACCAGACCCCTTCCAAGAACGGTCGATCCTTCGATCCCTTGTCTTTTTCTTCTTTAGTCACTGACG
GTCGGTCCTCCAGTGAAGATTCGGTCTTTTCCTCAATCTTGAATTGAGCTTCTTCGTCCCCTTGGGACTCACGGTGAAATCCCGCGTCTTCCGAAGATCC
TGGCACGCACACCATTTTGGTGAAATGGGTTCTCAAAACTGTGTGTTGAGCCCCCAAAACACTCACTGCGCCGGACTGACGACTTACAGGGGGGGTACCC
CGATTCCGCGTATGGACCTCACCTTGTGTACCCGTCGGCTGGCGGGTTGCACTCTTC