Description :
From Genome Similarity Track
Location :
Scaffold_18:292168- 295628
Transcript NameFunction/comments
Hyaar_Emoy2803204Sulfate Permease (SulP) Family

Sequence
3460 bases(100 bases per row)
CTTTGTTGCGTCTCGATGGGATTACAATCACAACGTTGTGGCAAGCAGCAGCAGCCCCATACTGCTGAGATTCGGTGCACTTAGAGCAATGTGCTCGATA
CAATCGTATTAGCCTCTAGAACCCCATCCGCCTATTCTTGATCTTCATATGATGTAGGTCTCAAAACAAAAAAAGACGGCATCTGAATCCTACAATTTTT
CGTAACTTGCTCTGACGAAATGCTCTTGGTGTACCCGCCCTAAAGTGCTATCGACGATTACCAAATAACCGATGCCCCTGGGTTGCGCTCGTGATTCCAC
GACTTTTGATTGCATGTACTACGGATGCATTCGTAAGTCTAACCAGCTGTAATGCTGTCGACTTTCATCATTCCATACGAGGGCAAAGCAGCCTGTGCTC
CGGCTCAATGCCGAAACACTTGTATTCGAACCCATTACACACCTCAATAATCATCTTACAAAGACGGCACTCTCCCGACAGCACTAAAAGTACCACTCAA
ATCGTAACAGCTGATGTTATAAACAGGTCAATCAGCTCCTTAAAACCTCACTTGGAGGACATCAGAACTTCCATCCAAGCGATAGACAGACAATATATAG
AACCGACATAACCAATCATCTGGCTGACTCCAAATATTAAACTAAGTATACCACACCAATTACCCATCCCTCTCGAATAAAACGACTTGACTTAGGGATG
TTAGGTAAATAGTCCCTGTTAATCACATATTACTTTTTAACAGCGTTAATAACGCTAAAAACAAGGCCACATTTTTTGAACAGACTTTTTACCAAACAAT
TATTTATTTCAGTCAAGGTTATAAATGGGAGGTTGCGTTGCAACCACTTCACTGTCCGTCGCCCACGTTACCGCTTATCCCCAAAAAAGAAGGAGACTTG
GCACTGGTACGAACCATTGCCTGCCATGTACGCAATCAGTCTTGAAGGCCCACTGTTTCCGCGCAAGAGTTTATACATGCCTTCTCTGTAATGCTACTAA
TTTTAACACATTCTTTTCGATTCGCAGCTTTAAAGTGTCCACCATCGGACGTCTTCATCTTCTGGTGTGGGCGTTCTATGAGAAGGTAAGAATATCTAGA
GAAAATTCAAGGCCAAGTGCATCTAGTATTCACTTAGTTTGCAACCATAAGAATTTTGCATGGAGGTCCTCGTTGCACAGGTATTCCACGTTGTACTGCT
AATTGTTTGCAATCTCTCTGTTAACAGAATGACACAGTCGTGCGCAGATGCTCCTATTGAGGCGAACTCTAAGGCTGAGAACCTCTTTAGCAACCGGTCG
GACGAAAAAAATTTGGTGCGTGCATTGTGTATGCGGATCTCTTTTCTTCTACATAGTGGCTAGCAAATTCCTTCCGATACGGTTTTTCCATCGCATTTTG
ATGTTTTCACTCGGTTCGGTCACTACATAATGAGTGAGAACCTGCTTTATGGAGGAGCTATGGTATTAGCTGTAAAACTGCTATAAGCAGGGTGAAACGA
TATTAACTGGTAAAAATATTAAAAGCTGGTAAAAAGTGGTAGGAAGTGGTAATAACGTTAAAGCTTGGTAAAAAGCGTTGATTACTGTTAGAAAGTCACG
GAGCTTTTACCTAACATACCTAACTTGAGTGGTCGCAAAAGAACTATATTGAACAGGTACTTCTACTACTCGCTCCCTTGTTCACTCCTTTTCATGTACT
CGCCTGCGCTCTCAGGAGCTGGGACGCATCGAAACGGCGTCCGTCGCACCCCTCGACGTGATATTGGCAACGTCCAGCGGCAGCAGCGCGATGGATCCAC
GCGTCGTCGTCACCGCAGTTGGGTGGACCATGATGGCGGCTCGTCCTCGCCGTCTCGTGGCAGCGAATCAATCGCTTTATTGGTCGGTAATGACCGTGAT
GTAGCTGACACAAATAGGGCCAATCGCAGGAGTTGGAGTAATTGGTGTATGCCACACCAATTTGGCGACCTCACCAATGCCCTTATGTACGGGATCATTA
ACTCGATCCTGACCATTCCGTGTATGTATGGCTATGCCGCTATTATCTTTAGTCACCCAACCTTTACCACGTTTATGCCAGCGCTGTCCAAGCTCGTGAT
GCTGTCCAGTGTCGTGCACCAAGTCATGTTTACACTCTTGAGCTCGCTGCCGTTTGCTATTGGCCAAGTCCAGGACGCCGGGCTCATTTTCCTCAGTGCA
ATTGCCACGTCCATTTGCAACTCGCTGGGTCCAGAGGTGTCACTGGAAGCCAAGGTCACGACTACAGTGGTTACAATTGGCTTGGCCACGGCACTGCTTG
GTGTCGTGCTCGTGCTGCTGGGGAAGTTTAAGCTTGCAGGGTTGGTGTCTTATCTACCGATGCCCGTTGTGGGCGGCTACCTGGCATATATTGGCCTCTT
CTGCTTGTATGCAGGCTTGTCATTGTGTACTGGACTAGTGATCAATGACTTTACGTCAATGATGCAGATCTGGGACCTGCACTACATGATACTCTGTATC
CCCGGTGCTTTGGGAGGGATTGTCCTGCTGCTGGTGGCACAGCGGTGCGAAAACTCGTTTGCGCTGCCTGCGACGATTTTGTTGATGCCAGTGCTGTTCT
TTGTAGTGCTGCCACTTTGTGGTATCTCGTTGGAGGAAGCGCGCAGCTATGGCTGGGTCGCGCCCGTGTCTGCCCCTGCTGGTTTCGTGCAAATGCTCGA
TCTATTTGATTTCTCGCAAATGTACTGGGGCCAAGTCCCTAGGCAATTTACGACATGGCTCGGCATGACGTTTGTAGTGGCTTTCTCGTCTTGTCTGGAT
GTGGCAGCTATTGAGATGGACATGGGCAGTCAGCTAAATATCAATCATGAATTAAAATCTGTCGGCTGGGCCAATGTCGTCAGCGGATTGCTGGGCGGAT
ACACTGGATCATATATCTTCTCGCAGACCATCTTTACATATCGCTCAAAGACCAATTCACGAGTCGTGGGTGTATGCGTCATTATTTCCGAGTTTGCCAT
CGTACTTGTACCGTTATCCGTCATGAGCCTCGTGCCGCGATTTTTCTTTGCAGCCGTCCTGATCTTCATCGCAGTTGACTTGATGATGGAGTGGCTTGTC
CACGTGTACCACAAGATCTTGCCTCGGGAGTATATTGTGTTGTGGCTCTCCTTCATTGCTATCAACATGGTCTCGCTTGAGCTTGGGATGGTGCTTGGTA
TCGGGTTTGCTATCCTTAACTTCATGATCGGTTACGCGCAAGTCCGTGTTGTAGCTCGCCGATCACGCTCCTCTGCTGCTGTGCGAAAACTTGCTGCTCG
CACTCTGCTTGGTCAGAAGCGCGACGCCATCGTCTACTTGGAGTTGTACGGGTACCTTTTCTTTGGGTCATCGGTCCAGATTCTCGAAGACGTGCAAAAA
GCTGTGTACATTCGCAAGCCCCGAACCGACAAGAAGCAAAAGTCAAGTAAAAAGTTGGGT