Description :
From Genome Similarity Track
Location :
Scaffold_24:29212- 31973
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_24-snap-gene-0.493-hydroxy-3-methylglutaryl-coenzyme A reductase
Pytul_var.sporangiiferummaker-pug3_contig_24-snap-gene-0.50Possible MAPK

Sequence
2761 bases(100 bases per row)
CGTCACACGGGACGTACCAGTGGAGGTTGTGATCTCTGTGGGAGAACTTTGACCGCGAGGCTTCGCTCACGACGCGGCAGTAGATGTCTAATGCACCACC
ACCGCGTTTCTTCATGTTAGGGCACAGCGACGTGTTTGCAAACGCGAGCAAGCGCTCACGATTGTCAGCGATGGCCTTCACGGCCGCTTCAATGTCCGGA
GTGTCGACCAGCTGAATCTGCGACGTCATGATGTTGCCTGAAGTCGCCGTGTGGAAACCACTGCCGAACGAGGCGACAAGCTTGGCAGCACTGGACGCTG
CAGCCACGACCGAAGGTTCTTCGACGGCCATCGGGACAGACAGGCTCTTTCCGTCGATTACAAAGTTCAGACCCAGTCTACAGACAGGATTCAAGTGTTA
GCTACGGTGTGAACAATGTCAATACACAATAGAATGCAAAACATGTCCATGCAGCTTACCCCAATGGAATCCCAATCACGCCGATGCAGTTTTCGATCAT
GAGATTCGCTGTGCGCATGGGCAATTCGCCCAGTTTGCCAACCGGATCCACCGACTCGATAGGTACGTCTTGAGGTTCGTTCTGCTTGATGCGACCGAGT
CGCGGATACATCAGCGACAGCACATCAAAGCGTTCACGGAGTGTTTTATTGTAAAAGCCCGACCATACAGACGGCTGGGACGAATTCGCGGCGACAGCTT
TCGTTGCCAACGACGTGGACCATGCGTCACTTTCATGCGTACTTGGTTGCAGCGGATCAAATTTCTTGCGCTCGAGCACGTTGTTGCCTTGCTGCTTGGC
TACTTGCTCCAGGCACTCTCTGATCTCGCTCGCGAGCACGCTGATCTCATCGACCTTGCTCAGCACATTGTCATCAACGTGCACAGCCGTATTGCTATGC
GGTATGGCATGATGCTTGGCTGCCTTCAAGAGTGTTCGCACGTGCAAAAGCGCATCCTCAACTGCATTGTGGAAATCACATGTGCTGTTGCTACCGTTTA
CTGCCGGCCCGTTGGCATGGTATCTATTGAGCGGATCCACTACCGAAGCCACAGTTGTCGCCATCTTCAGTCCTCAATGGTCGCTGCTATTCTTTGTTGC
TTGGGTGCAATTGTGTTCGTGATATTCAAATCTGTTGTCGATGGGAAGCTGCTGTCACATCCACTGGCAGGGGGTCGCAGTCACTTAACTTGCTTGTCTT
GCTCCTGATGGCGTCTGTCCCTGGCGTTGGGTGCGCGAGTGCGTCGTACGCAATGAGGGTCGTGTGCTGCGTTTGGCAGGTTGCGCAATGGTGGATGATA
GCGGACCGGCCGAGCGGAATACTGAGGAAATCGAAGAGGTCTTCGTAGCCGCACGCGCGTAGTTTCTATTTCCCAGCTTGCAGGAATGGCCCGTGGGCAA
CATTCACAGACCATCACTCCTTTTTTCCCTTTGCCAAAAATACGGACGGTTATGGTGACGACGGCGAGTCCCGGACGGGTGGGTTTTTCACAATGNNNNN
NNNNNNNNNNNNNNNNNNNNNNAGTCTGAAAGAGGTACTCGTTCAAAACCCGACCTGTAACAATGAATTTATTCAATTGCTTGTAGCTTGAGCGGGTGGG
TTTTACTTCAAGACCCATTCATCTGCAGGAATAGACAAACCCGACCCGCTTTTACACCGAGTGTTGCATTACCCATCAACCCTCACCGACGTAAACGAGA
CTTTGGCGTCAACGAGTTCAGCGTGACAAATACCAAAAGACGACGCGAACGCGTCCACAAGTAGGTGGGAAACGGCCCACAAAATGGCTACATTTCCGTC
AGTCTCACGTGACGCACGTACTCATCACTCGTGATACTTTTTCTGTGGATTTCCTCTGCACCCACCAAACAGCGAAAAGCTATTCTTCCAAAAGCTCTTC
TTCTTCCTCCCAGTCGTTCTCTGCGTACGACTCGTCGTCGTCATTGCGCTGCGGCGGACGCGCAGACTTCGCTGGGGATGACGCAGCAGACGCGCGCGAG
GGTTCAACCATCGTTTCTTCTACGGTTGCGAGCGTTTCAGCACTAGTCGGTGCTGCAGACGATGGTGGAGACGTGAGCAATGATGACGATGGGAGGATCG
GTAATCGCTCCGGCTCATCGAGCATCTCTGCTGGAAGCAGCTCTGTTTCTTGGGGCAAGGGCAACAGTGCTTCTTCTGTCTGTGGTATCAATGACGATGG
AGTCTGAGCACGACTTGAAGGACCTACACTGTCCCCGATACCTGGGAGATCCAGTGACTCGTAGCTTTCTTCTTTGACCAAGTCACTCCTGCTCGTCGCG
TTTCCTGGTTGCTTCCCTGATTTCTCTGGAAAAATGCCCGAAACAGTGCTCGTTCCGTCGAGACCGTATCCACTCGAATACTCAACTGCATCCTCCAGTT
TCTTTGTCAATAGAGCAGCCAACTCGTCTTCCAGCTCCTCGCTTTCTAGATGTTCATCGCGATGTTTCTTCCAGCAAAGTGCTCGCCAGTAATGCGGGAG
CTCGAGAGTGTTGTCACAAGTCTAGTGCAAATGGCATGTGTTGTTGGGTGATAATGAGTGAGCACCATTACCAATAATTATGTCATGCTAGTACAATCAT
ATAGTGTCTTACATGTGATTGCGGGAGCATGAGCAAAACCTTTTCGTTCTCTGCTGCCGTCAACGCTGCAAATGGCATTTCGATGCGAAGGAACTACACA
TACACAAAGTTGCAATGAAATCAGAATCATGGGTACATCATTAACAAAAGCGTATATCTTA