Description :
From Genome Similarity Track
Location :
Scaffold_1913:2921- 3930
Transcript NameFunction/comments
Phyag_g11731hypothetical protein PHYSODRAFT_289089

Sequence
1009 bases(100 bases per row)
AATTACCTAGAGGAGCAAAAAAGATCACCGAGGAGGACTATTTTCTGCGCCGGACGGAATTTCGAGTGTGGCTCGCACAAACTAAGTTCGTCTTCGTCTG
TTGCTATTTTTAGTCCAAACCAAAGTTGGACTAAACTGATTTGATCGTCTTATTTGTTACTAGGAGCAAATATGTCGATGATCTAACCACGGACGAAGCT
ACGCAATTGTTTACGGACGAATTTGCCAAGAAATGGAATCGCGGCAAATTATCCAAAATGTTCTACGAAGGTTTGCCCGATGCTGTAGTGGAGCAGACCA
AAAGAACTCGTCACAAATGGGGGTTCGTGGCAAAACTTGGCGAAAAGGAGAAATTTGACTTGGCGACGGCCAAAGACTCGGTGGATGTGGCCACGAAAAA
GGAAAATTTGTTGAGTTCGGGGGAAAAGAGAGAGATCAAAGGACCTAAATTGGAGGAGGACAGAACCAGAGACAGGAGCAAACGTCGATCCAAGGAatat
gaagaagatgacagGGACGATGACAGGAAGCGTCGAAAATTGGAACGCAGAAGAGAACGAGAATATCGGGACACGGTGATGGAGGAGTTGGCGCCGAAAG
CGACAGGTAGAGAGGCTCAGATTGAAAAGAGACGCCAATTTGGAGAGAAATTGCACGGAGCTGCGAGGGACCGAGAAGATGCACGTGACGGTCTCGATGT
AGGAGAAGACTTTTTGATGGGTGGGCgaggaggtgacgacgacgacttgaaGCGTCGAGTGGCTCAGCGAAACTCGGCTCGGCGTCGTaaacaggaggag
caggaggagaaacTGGCAGGGCTGAAGGTTCGTGTTTGTATTTTGTGGGTGAGTATTGTGGGTCACTGATAGGAGGCTGTGTTTGTGATTATATATGATG
CTGCTAGGCGAAGGAGTCCGCGCGTATGGACAAGTTCTTGGAAGACATGGGGCTTGCTGGTCCGAATGCTAACGGCGGGAGACCGATAACGATCGCGCCA
CGTCTCTAA