Description :
From Genome Similarity Track
Location :
Scaffold_82:292058- 299026
Transcript NameFunction/comments
Physo_140172reverse transcriptase
Physo_140173hypothetical protein

Sequence
6968 bases(100 bases per row)
CCGAAGCCCTGTGGCTCTAGGGGTCGCTGGCAGAAGCCGCGCCCCAGGAACCAGGGGAACGCCGGACACCAGTAGGGGCGGGGCGCCCTACTGGGGAAAC
ACTAAGTCTTCATGAGGGGCGTGCGGGTGGCGCACGCCATGGGGACTTAGCCCCTGAGAGTCTCTGAACTCTAGAAGCGGAGAAGGGCAGCGGTGGGCTG
CTTGTGGTGCACGCGAGTGTACCGGGATACGATCATCCCTTGAGAATCTTGATCGACTCTGGGGCGTCCAAGAACTTTGCGCGCCGCCAGACTGTCGCAC
GCAATCGCGACAAGTACGCCGATGCGCTACGAGGCAGAAAAGGCAACGGGCTGGTCTCGGTAAGACTGGCCGACGGTACGGTGGTAGAAGTACCTCGGGT
CCACATGGACCTCACTGTCAAGTTCGAGGACTTCGACAGCACGGAGCCGTTCTTGGTTCTAGACATGGACAAGTACGACTTGATCCTTGGCATGCCGTGG
CTGGAGAAACACGAGTCTTGGATCGACTGGCGCGGCAAGGCCAGCGGGGCCAGCCGTCCCCCACGCTCTGACAGAGCTTTGGTCAGTCATGTTCCCACCT
CTGCCAGCAGCTGGGGCGCCCGCGAGGGCCGCCAGGGCGCAGCAGCATCTAATGAGTTCTTGGGGTCCGTCGAGACTGACGACGACTCCGACCTGGCCGG
ACAAGGCCTGAGAGTGGAGGTGCCGGACAGCACCTACCAGGTGGTAACGTAGGTCCACACGCGGGTAACGAAGTACCGCAGGCAGCAAGGGCTGCTGGAG
AAGGCGCCGCTGGTGTGGCGTGGGTAACCAAGTTCCACGCGAGGTCACTCAGACCGAAACTGATGCGGAAGGCACTGCAGGCGCTTCCGATGTGGGTAAC
ATAGTTCCACAGGAGGTCACTCAGACCATAACTGATGCGGGAGTCGCTGGAAGCGCTCCTGGTGTGGGTAACCAAGTTCCACACGGCGAGGTGGGTAACA
TAGTTCCACCCAGCAAGGCGGGTAACCAAGTTCCGCTCAAGAACAAGGCGAGTAACCAAGTTCCGCTCAAGGACAAGGTGGGTAACGTAGTTCCGCACGA
GATCGAGAAGATCGGTGGTGCCGTCAAGGCGGCGCCACGAGACGAAGACACCCGAGGGTCACGTCGTAAGCCGGGCCTAGTCGTGTGGCCGACGACGCCA
GTCGCCAGCGACTCCGAGCCTCCAGCCAAGGCTCCAGCCGCCGAAGAGTGTTATCACATCTTCGACGGCGTGACCGGTAGTCGGGTCAAGACAGGAGCTG
TCGAGCTTACAGCTCTGCCCGAGGTTTCGGAGTTGCTGAACCTTGAGGAGCTCGCCATGGAGGACTTCTTGGCCGAGCTAAAGGCCGGGGAGATCGCAGA
GTTGGTTCTCCTCCGACCGGAGTCCACGTCGGCCGAGTTGAACTCGTCCTCGGTCATGGACCAGGCAGTCCTGGAGGAGTTCCAGAGACAGCGCGCGTCG
CGCATGGGCTCTGAGATTCTTAAGAACCCCCAGGACCCGGTGTACCCCTTGGTGAAGGAGTTTGAGGACGTGGTGTCCAAGGATCCACCGTCCAATCTCC
CTCCGGACAGGGGAATCAGGCACGAGATCGATCTCGTGCCGGGCACGAAGTACTGCGTCACGAGGCAATGGCCTCTTCCCCGGGAGCAGTGTGAAGTCAT
TGATGCCTTCTTTGCCGCCAAGGCGAAGGCAGGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGACGCCTACCTTCTGTGTTCGCAAACCGAACGAAAAG
TGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCGACAGTGCCTGCGCAGACACCGATCCCGCGCAAGGACGTGTTGCTCAACAACATGACCGGCT
GCACGCTGTAAAGCGCGCTGGACCTGGTGGACGGATACTACCAGATCCTGATGCGCGAGAGCGACATCCCACTCACGGCTGTGAGCACGCCGAGCGGTAT
GCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTCTAACGCCCCGGCAACGTTCAATCGCTTGGTCACACAACTGTTTCGACCTTTGCGTGCGTTCACA
CAGACGTACTTTGACGGCATCTTCGTCCACAGCCGTGCCGAGGCAGGCCAGACGGCCATGGAGGTGCATCTCCAGCACCTTTGACGTGTGTTCGAAGTCA
TGCGGGCCAACAAGCTGTACGCCAACATCGACAAGTGTGTGTTTGCAGCTGAGGAGATCAAAGTCCTGGGCTGCTTCGTCAGCAGCGCCGGGGACCCGGA
GAAGGTAAAAACCATCGCGGCTTGGCCGCCACCTCGGTCGCAGAAGGACCTACGACAGTGGTTGGGCCTCGCCAACTACCTGCACAAGTATAGTGCAGGC
TACGCCGAGCTGGCACGGCCCTTGTCGGATCTCCTGAAGAAGGATGTCGACTGGCGCTGGGAGCGTCGCCATCAAGATGCTTTTAACGACATCAAAGCGA
GCTTACAGCGCGCGCCAGTCCTGGCATTGCCGGACGAGACGAAGCCTTTCAGCGTAGTCTGTGATGCGTCTGACTACGCAATTGGCTGTGCGCTATTGCA
GGCCGACGATGAAGGCCGCGAACGGGCCATCTCGTTCCAGTCCAGGCAGCTCAAGGCAGCCGAACGGAACTATCCAGTCCACGACAAGGAGCTACTTGCC
ATGAAGTACGCTCTTGTTAAGTTTCGAGTGCGCCTCCTGGGCTCGACGCCCTTTGTCGTTTATACAGACCACGCGTCCTTGCGGACTGCCGTCAACACGC
CGCATCTCTCACAGCGGATGGCGCGTTGGCTGTCATTCTTCGCGGAATACAACTTCCGTGTCGAGTACAAACCGGGCAAGTTGAACGTGCTTGCCGACGC
GCTGTCGCGCCGACCCGACTACAAGCTTGCTCATATTAGTCGGGTCACGACGGATCTGTATGATCGCATCAGGCTGGGGTACCGAGACGATGCCAGTCTC
GAACCTCTTGTGCGGTTCTTGGGCGCTGGCTCGGAAGCCAAGGCCGAGTGGCTCACGCCCCGACAACGTGCAAGGCTGCACCGCTATGAGTGGGCTGACG
GTTTGCTCCACTATAGGGTCGAGCCCGAGGATCCTCCCCGTATTGTCGTGCCCAACGACGAGGATCTCAAGTACGACATCCTGATGGAGGCGCACGACGC
TCCATCCAGTGGCCATCTCGGCCGTGAGAAGACGTACGCGTCTGTCTCGCAGATGTTTTGGTGGCGTCACATGTACAAGTGGGTCGCCACCTACTTCCGT
ACGTGCGAGAGGTGCCAGCGCGTGAAGCCTGCCGGTCACGCCTCGGCACCATTGCAGAGCCTGCCGGTCCCAGCGGACTGCTGGAAGTCGATGAGTCTCG
ACTTTGGCTTCGGACTTCCGGCCGATGACCGTGGCAACACTGGCGTTGTTGCCTTCGTGTGCCGCCTGAGCAAGATGGTCCACTTTGCTCCAGTTCGTGA
CACCGTCACTGGCGACGAGGTCGCTCGTCTGTTCATGGACTGTGTCTTCCGACACCACGGGCTGCCCGAGACCATTGTCTCTGATCGAGACCCGCGGTTC
ACCGCTACGTTCTGGCAGACGCTGTTTCGCCTTCTCGGCACACGACTGTCGATGTCGACGGCGGACCACCCGCAGACGGATGGCCAGACGGAGCGCGTCA
ATCGCGTGCTCGAAGACACGCTCCGCAGTATCTGCGCGGAGATGCCCCACTCTTGGGCTGATCGCTTGCCCATGGTTGAGTTCGCACTCAACAATGCGGT
ACATGCATCGACGGGCTTTACGCCCTTTTACCTGAACGGGTTGCGCCACCCTCAGGTGCCGCTCACATTACGAGGCAGTCCCGGGGCTTCGGGCCTAAGT
GGGGGAGAGGCTCGGAAAACCTTTTCCTCCCAAGTCTCGGACGTGAGTCCAGCCACCTTGCGGAAGCAACTGTCCTCGTTTGCCGAAGGCAGGCTGAACA
TAATCAGCAGGGTGCGAGACACCATGGCGCAAGCCCAAGATAAACTGAAGGAGTACTCTGACCGAAATGGAAGAGGAAACATGAACGTGTTTAAGGTTGG
GGATTTAGTTCTCCTAGATACTAGAAACCTACCGCTAAACACTGTTAGCTCGGTCGAGAGCAACAAGCTGAAGCACCGCTTCATTGGACCCTTCACGGTC
CTCAGCCGGCATGGCGAGGCGTACACCATAGACTTGCCCAAGTCGATGACGACTCACCCGACGTTTTACGTGGGTCGTCTTAAGAGGTACCATGACCCTC
TGGCTCTGGCTGCCCCGCAGGAAGCGGTGGGTGGCCCGGTGGAGAAGAGCGCAGCTCCTCGAAGCGCGTCGTCGAGTCGCGGTAAGGTGCCTGATACGCG
CGCTGGTCGTAAGACGGCGCGGCGTACATCGGAGCAGCATACGCAGGGGCCCCGTACGAGCGCTGACCAAACTGGGCCTGATACGAGTGGGGCTGCTGCT
GCTCCGGATACGGCGCGTGGCCATGAAGCTCGGCCCGAAGGCCAGCAAGCTGGTTTCGCAGCGAGTCGTAAGACGACAGGTCGGCTCGACGATCCACACG
GCCATGGAGACTGCGAGTTTCTTGATAGAGCGAGGCAACATCCTCACGGAGCCGCTCCACGGCACCAGGCTGACCAGCACGAGCGGCAGCCTCGCCACCA
AAGCCGACGCCAAGCGCGATCTCGAGGACGTACACACGGTCCCGGAGAAGACGAATCTCCTCTTGCTGCAGGGCCACCACCTGACTCGGGGCCCCAGCAT
ACGGCTGCGTCGCCTCAGGCTCGTAGCCATGGCCGTGCGAGGCCACCGCCGACCCTCCTTGATCGTAATGGGCAGATCCACCACCACGTGGAACGAGTCG
TCCGGGAGCGGCGGCTCCATGGCAAGCGCCAGCTGCTCGTGAAGTGGAGGGGTTACCCTGAGTCGGATAACTCGTGGGAGCCCGTTGAGCAGCTGCCCGA
AGGCTGTTGCGATTTGGGACGAGAAGCAGCGGCAGCTTCGTAAGTAGTCCTTGGCTTCTTGGCCGGTACCCGGGGCACGGTAGCAGACGTAGTCGCACCA
CGCCCACGCTCTTCACGAGCTTTGGCTCTCGCCTCTTGCTTCAGCTCGTCCATTTTCGAGTGGAGCTTGCGCTTGCTCACGAGTTGAGCGAACTCGATGC
GGAGCTCGCGCACGTCCAGGATTGCGGACAGAGTGCGATCATCACGGAGTTCTTTGAACTCTTGGTCGGAATACCCTTTGCGCTGGACGTAGCGCCAGAA
GAGGTCTTCCACCACGCACCAGGTCATGTTGTCATTCGGCTTGACCCAGTGGAAACCCCACACAGGATGGAGTCCACCCTTGTTCTCCGGCTTCTTGCGA
AGCGTGGTGAACTCCTTCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACACCGGGCGACTTCAACGTCGCCAAGAAAGAGTGGCTCTTTCTCAACAAGAG
CACGCTCATAGGAACCCCTCGAGGTGTACCCGCCGATAAGGCCACGAGGAGCCGAGAGCTTCTCCAACAGCGCTGGCGCACCAGTGCCAGGCTCGAGCAG
GAAGTAGCCCTGCGGGTACGTGGCATCCCCGCCTGAAGAAGACTCGATGGCAGTCGTGGCAGTCGGCTGCCTGGCATACGCACCCGAGCTAGCAGCGTGG
TATTGCTGCTGCTGCTCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGTGGACGGCACCCTCCTCGTCCTCAGACTCCGAGTCGATGAACAGCTTGGAGC
TGGAGCCGCGAGGCGACCTGGAAGCTGAACGCTTCTTCGCCTTGTCCTCGGCGGCGTTCGCAGCGGCAGCCGCTTTCGACGCTTGGGCACGCTCACGACC
TTGTCTCAGCGTCAGATGCTTGGATGCCAGCACCTCCTTGGGCTTGGAGCCCGCGTAGCTCGGCGACTTCTCGGCCACGACCCCAGCGTCGGCCATGGCG
ACTTCGTCGTGCGACTGCTTGCTCTCGCCTGAGCCGGACTCGGCGTCCTCCGCCTCCTTCTCTGACAAGGCCTTTGCGTCGGCCGAGGCGTTGGTCATGT
CGCCTGCCGCCAGCTCCGTGCCTTCGGCAGCGTGCGTGCTGCCCTCCGAGACGTTCTCGTCGTCGGGTGAACTCTCACCGGAGTACTGGACCATCGTGCA
GTCAAAGACGGCGGCTTCCCAGTCGCGAGCCGGGCTTTTATGGTCCCGAGGACTCTCCTCCTTGCCTTGCGCGGCGTCAGGAGACTTTCTCCGAGCCCCG
GCCTGACGGCCACTCTTCGGCGTGCTGCTACGAGAGCTCACCACCTCCTTGGCCGCCTTCGTGGCCTCCATCAGCACGGACGACTCGTCCTTGGCCTTGG
CCGCCCTGGTCTTCGGCCCTACGGCCCGCGGTTTCGGAGGTGCTTTCGCACTGCGCGCACTGCGCTTTGGAGGCATGCTTCCGGTCGACGTGGAGACCCT
GCGGCTTGCTCGGCGATGCGCCAGTTGCTCTGTGAGGCCCGGGAGCCGAGGCGCCAGAGCTCGCGCCGTTGTCGATGGATTTCGACTTTGCGAGTGAAAT
GTGAGTCGCCGGCGTAACCTCGCTCTGATTGGTCGATAAGATCGAATCTAAGTGGGGGAGGATGTAACGGGGTTACATGGAATAGTGATCCTGTCACTAT
TCCGGGATGGCTACATCGGTCACTCCCCTGGATAGTGACCCAAGTGGCCTCAGAGCCAACAGATACATTTTGTATGACACAAACTATAGGGAACTTAGGA
TTTGTATGCAGGCCAAATCTGTACCAACCTATAACTGCATTCAGTCTTAGATCGCCCGCTTTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGA
GCGGCTGTTCACTTGGAGTTTGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACA