Description :
From Genome Similarity Track
Location :
Scaffold_53:292051- 325155
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16111ATP-binding Cassette (ABC) superfamily
Phypa_INRA-310PPTG_16112ATP-binding Cassette (ABC) superfamily
Phypa_INRA-310PPTG_16113ATP-binding Cassette (ABC) superfamily
Phypa_INRA-310PPTG_16114ATP-binding Cassette (ABC) superfamily
Phypa_INRA-310PPTG_16115hypothetical protein
Phypa_INRA-310PPTG_16116hypothetical protein
Phypa_INRA-310PPTG_16117hypothetical protein
Phypa_INRA-310PPTG_16118hypothetical protein
Phypa_INRA-310PPTG_16119hypothetical protein
Phypa_INRA-310PPTG_16120hypothetical protein
Phypa_INRA-310PPTG_16121hypothetical protein
Phypa_INRA-310PPTG_16122hypothetical protein
Phypa_INRA-310PPTG_16123ATP-binding Cassette (ABC) superfamily

Sequence
33104 bases(100 bases per row)
CAACTGGAGACAGACACGTTGGTGCCCGATGTAGTAGCTCTGCAGACGCTTCAGGACTTTACTCGCTGGACCAAGACTGGCGATCTTCTTCCTTATAAAC
CTAAGGGGTTCTCGGAGATCTACGAAACTCTCAAGGATGAAAGTGGGTCGTGGATGGCATACACGATCTTCACTTTTGGGTTCGTATATGACTCAAGTGC
ACTCAACGGGACGGCAGCACCTTCGACGCCTGCTGATCTGACAGACCCGAAGTGGGCTGGTAAGATTGCGTCATCTTACCCCCACGACGACGACGCGGTG
CTCTTCCTGTACACGCGCTATGTGGAGAAGTATGGATGGGACTGGGTGGCCAAGATGGCCCAGCAGAACATCGACTTCAACCGTGGTTCGAATGTCGCTA
GCGACTTGGTCGCTGCAGGGGAAAAGGTCATTGGTGTTGGTTCAAGCGGCCGCGCCGATCCCATTACCTTCGTTGGTGGCAATGGTACGGATTACCTTAG
CTGGGGCCAGCGAGTTGGCATTCTTTCGAAAGCCAAGCATCCTGCCGCGGCAAAGTTGTTCATGAATTGGGCCGTGTCGAAGGAGGTGCAGGAAACGGTG
ATTTCGACGACGGTGCGTGCCGACATTAACACCACCCACCCTTGGAGCATCCCGGAAGCGAATATGGCAGCTTTCCCCGATTTCATGGAGGACCGATCCA
AGGTTGAGCAGTGGAAGCAAACATTTGCACTGTACTTCGGCGAAGTGCAGGGGGAACCCAGTCCTGGGGTCCTTGGACTTCACCCCGGCCTCTAAGCGGA
CCTCCTGTTTAGCTGCTGAGTTTATGCAGTAGGAAACGCAACGTAGCCCTTTATACATGACACGTAGTTCACGCTGTGGACCCAAAACAACAATATAGTG
GCAAATTCTTTATAATGCTCCGTCGCAGGCTAAGACGGACTCGTTCCTCACGGGATACGTCGATATACGTCAGGGAATCCACTTAGGCTACAACATCGCA
GAGCATTGTGACCTTTGCGCCCCACCTCCAAAAAAACTGGTTCGGCACCTATTTCTTTTTGCCAATTTAAAAAAATCGGTAAATTGGCCACCTCATTTTC
CTTCGTGCAACATTCACGATAAAAATAGGTTCCACTCGATTTTCTATTTGGACATCTCTCTAAGAGAGATGGTAAGAAAATGCCAGAGTTCAAGCATGCA
GCAAGGAAGTTAACGGTGGTTATTAGTCTTGTACGCGTATTCCCCCAATGCAATTTGGCGTGATTTTTCGATCGGGGTTCAAAAAGACAACATCCATTCA
GGATTTACCTGAAGCAACTCTTACGGCTTCATTTAAGACTAAGGGGCATCTCTTGATAACGTGGCAACTGTTCGGATGATTGCGCTGGATGGTAGTGCGA
ACAGCTTCATGGATAGATATTCTGCTTGTTTGCTCTGAAACATGAGAGGGGCTGGAACCATCCTGCAGAACTCCAAAGATGGACACTTCTTTTGTATCGC
TAACCAAAGATCCAAATGCCTGTTTGAGTTTATCCGCTAACTATTTTAGCAATTTGTTAGCTCACACAATTTCGAATGCAATTTATCCCCTAGACCTAGA
TGGAAATCACTACCGTTACTTCAGGTAGACTAATGACCAAAATCGGTTTTACTTAAGTACAAGATTCCGGCGTAACTGCACTGTGGGTATTTTTCGAGGG
ACAATCAAGATTTTTATCGTCGTAGTCTAGAGTAAAATGCGGTTGAATTCATATTTCTAGATTTCTGGCTTTGATCTCGATTTAGTAGTTTAGGCGTTGC
CACTTAGAATCGATGCAGTAGGATCTTTAATTTCCTTGTCGCGAACGCTTAAACCCGTTTACAAACCAGGGTGGACGCCAAGATAACCTGGTGTCGGCTC
ACCCTGCACCTCACCGAAGTAAAGCGCAAAGGTCTGCTTCAGTGCCTCCACCTTGGTTCTGTTAGCCATGAAAATAGGAAAGGCATCCAGGTTAGCCTCT
GGGATTTCCCACGGATGGCTCGATCCAGTTGGAGCAATATCTGTACGCACTGTCTCCATCACGACGGACTCCTGCACCTCCGTTGAGAGGATCCAGTTCA
TGAAGAGCTTGGCACTCGCCGGGTTTTTAGCCTTGGCCAGGATAGCAAGACGCTGGCCCCACGTCAGATACTCCGTGCCATTGCTACCCACATACACGAT
CGGAGAGGCTCCAGCGTAGGTGCCCACGCCGATGACCTTGTCTTGAGCGGCCACGAGGTTGTTCGCCACATGTGAGCCGCGGTTGAAGCTAATGCTCTGG
TTAGCCATAGCGGTGACCCAGTCCCAGCCGTATTGTTCCACATACAGACTGTAGACGAATAAGACAGCGTCGTCGTCGTGAGGGTACGACGAGGCAATCT
TGCCAGCCCACTGTGGGTCAACCAGGTCAGCCGGAGACGTGGGGGCGTCCAGGTCGCCGAGGTTACTCGAGTCGTAGATGAAGCTGAAAGAGTTCACACC
GTACGCGAACCAGGCACCGTTTTCGTCCTTAAGGCCGTCGTAGATCTTGGAAAAGTTGGCCGGCTTATACTCAAGCAGGTCGCCCGCGCTAGCCCAACGA
GGGAAGTTCTGCACAGTCTGCAATGCTGTGATGTCCGGCACAAGCGTGTCGGTATCGAGCTGGTTGTCAATGCGTACGTCGTGGTACTTGCTGTAGTCCA
CCACCATTGTCAGGTTGATTCCGGGGAAAGCGTTTTCAAACGCAGTTTTCAATGAGTCCTGCTGGCTGGCAAGGTCACCGCCGTGGTAGAAAATGAGCTT
GCCACCTTCAGCGATAGCGTCTTCGTATAGCTCATTGAGCGTTTTGGTCTCTTCTTCGACGGCGTCAGCACTAGCGGCAAGGAGGGCGATTGCAGCGGTG
ATTGGTGCGAAGAGCTTCATTGCGGTGGTGAAGGTTTGGCACCGGTGTGATTAACGGGGTGCAAAACTGAAAATGACAAATGACCGCCACCACCACTGGT
GGTGAGCAACGTGCTCCCATGGAGTGGTTTCTATCTCAAGATGAGTCTCACGATAGTACTTACGAGTGCGCACTTTAAAGGGTCTTTTGTATTCTTGTAC
AAGTATCAACGTGCATTCGTTGAACAAGGGGCTGATCAGCCATGTAGATCTGCAGGTGGATCTCGCGAACTAACGAAGCTCGCCATGATGGCGGCCATCG
TCTGGTTTTTCGAGTGCATTTGCGTGAGCAAAAGGAGCGTGGCAATCTGATGATCTGTTGTCGGTGCCGATTCCCTTTGTCACAAACAAAGTAGAGTTTT
GTATGGCTTCCGTGTGGCTTCCGCAGAGTGACGTTACTCCACCCACTGACGAGAGCGCTTTGCAAGATGTTGAGTCGAGTCAATGTCGTTGACTCAACGA
ACGATGCACAAGCTTGCCATAACTCACCAACCCAAAAACACATGGGTGTGTGCATTTCTTTCCATATTCTTTGGTCAGAGCATGCGATTGCAGGGAGGAG
GGCCCATCAGAGGGGCGGGGGCTCAGTAGCTCAAGATCCCGTGAATAACGAGTGCATGTTCTACCTACCATACGAAAACCGCGAGGAATATTATGAATTA
TGAAGACGTTGAAATGAGAACCACGTGCCTTTGCCGTGCCTTTGCAGATCGTATTGGGGTTCCCGTTTCAGCTGTCATATGATGCAGGGTCCTACCGCGT
AAACTTCGACTGCTAAAAATGATGTACCCGTTTAGAGGCCAGGGTGAAGTCCAAGGACTCCAGGGCTGGGTTCTCCCTGCACCTCGCCAAAGTACAGAGC
AAATGTCTGCTTCCACTGCTCCACCTTGGCACGATCCTCCATGAACTCCGGAAAAGCTGCCATGTTCGCTTCCGGGACATCCCACGGCTTGTTGGCGTTG
ATATCCGTCCGCACACTGTTGAACACCACTGTCGTCTGGGCTTCCTGGGAAACAGCCCAGTTCATGAACAGCTTGGCAGCAGCAGGATGCTTGGCCTTGG
ACAGAATACCAACTCGCTGACCCCAGCTCAGATAGTCCGTACCGTTTCCTCCAACAAACACGATCGGAACGCCACCACCGCCCGTACCCACACCAATCAA
CTTTTCCCCAGAGCTGACAAGCTCACCCGCGACGTTCGATCCACGGTTGAAGCTGACATTCTGGTGGGCAAGCTGAGTCACCCAGTCCCATCCGTACTTC
TCAACGTAGCGAGTGTATAGGAAAAGCACAGCGTCATCGTCGTGCGGGTAGGACGAGGCGATCTTGTTCGTCCACTGCGGGTTTGTCAGATCCGCCGGAG
TAGCAGGCGGTGCGAATCCGTTGAGTGCTGTTGAGTTGTAGATGAAGCCGAACGTAAAGATGGTGTACGCCAACCACGCGCCATTCTTGTCCTTAAGAGA
GTCGTGAATCTTTGAGAAATTGGCGGGCTTGTAAGGGAGAAGGTCACCATTCTTGGCCCAGCGGGTGAAGTCCTGTAGCGTCTGGAGCGCCACCACGTCA
GGCACCAGTGTGTCGGTCTCCAGTTGGTTGTCGATGCGCACGTCGTGGTACTTGCTGTAGTCAACAACGGCAGTGAAGTTGATTTCCGGGAAGCGCTGAG
TGAATGCATCGTGAAGACCATTTTGCTGCGTAGGTGTGTCACCTCCGTGATACAGGATCAGGTTGCCACCTTCAGCAATAGCTTCAGCGTAGAGTTCGTC
AATAGTCTTGGACTCCTCGCCAGATTTGGCTACGACCCCAGTGGAGACAAAAGCACAAATGGCAAGGAGCAGGGTAAAATGCTGCATTGAAGGGGGCCGT
GGACACTTGATTTGGAGAAAGGAAGTTTTGGAATGACCTGATAAACTGGCCGATCGATGAATGGGCTAGCGCTGAAGGAGTAAGCTTCTCATGAGTAAAC
GTCTTTAGCTCTACCGCCATTGTGCTGAATTCTCCACCTCAGTGTCTCGATCGTACCGTCATCCGTCGGGGTTGTTGTGGTACTCTCGGGTGATCTTCAT
GAGCTCTTACACGTATTTACTACATGTAGTGTCTAACCGTAAGAGGGAAACCGGATAAGCTTACCGTAATGTAATTCGTCTGAAACAGTTGGCAACTAGC
GGGGGATCACTGATCCCGGATCACGCAGTCAGAGTTTGGGTAAACAGCGCTAGCTGATCGATGGACCATCGGCGATGGTAACTGGGCATGCCAGCACCCA
ATTGAAGGAAACAGGGAGCTTGCGTGGCAGATCAACGGAAATGGTGGCTTACGATATTGATATGGGATTACACGTTGTACCGACAGCATCATATGCGGCC
TCCAAACAAAAAAGTACAGTACATGTACATATAAAAGCAGGAGTCTGTTTAAAGCAGATCCTACACCAGCAAATCTTTAGTGGTCAGTCCGCGCTTAGCG
AATTTCGCAAGTTGCACCCCAGCTGGACGTGACGTCTGTCTCCAGGTTGGAACGCCTTACTTGAAGCAGGGATATACTGTATACTAGTATCAGATACATG
TACATTATGTACTTTAGTATAATTTGAGTTTGCTCGTATTCACGCCGGAAAGCCCATGACAACAATATGCAATGAATACAGTACAAGATACACAGTAGGA
ATTGGAAACGTGTTGTGCTATGTACAATGTACCACGCATTTTACATGCACACGCTGCTTTGATGACTGTTTTGAAGTCAATGTACATGTACAGACAACGT
GTACGTGTATGTGTACCGTAATTATGGAATTTTTATTTTTTATTTGGCGGATCAACGCCTTGCGGCCCAAACTCTGGATGGTAACACTAAAAGGAATATG
TAAAAAAGATCGTTTCTTAATATTTTTTTAATCTTTTCTACACTTTAATTATCTTTTTTTTTCGTTTTTACCAATGGCACCACCCTAGGAATCACCCTAG
CGAAGTTATCCTCAGTCTACCCAACAAGATCAACAAGAAAGAAATTCATTTTCAAATATGCTGCCTTAGCGCCAAGTCGTTCAAAATTCACCTGCGATTC
ATCAGCAATGCAGTTCTTTGCCCTGCTCGTCGTAGCCTTCATCCTGCTCAATTCCAACGTAGTAGCCTATACCAAGTCCGGTGAGGAGACTAAGACCATC
GATCTCCACTACGCTGACGCTATCGCTGAAGGTGGCTATCTCGTTCTGTATATGGTGGAGAGACGCCTACCTCACAAGATAACCTTCGTGGTGCAATTGA
GAAGCGCTTTCCGAAAGTCAATTTCACTGTCGTTGTCGACTACAGCAAGTAAGTACCAGAGTGTGCACATCGACACCCGCTACGTCGAAAAGTACAACTG
GGACTGGGTGACTCAGCTTGCAAGCAGAATGTCAGCTTCAACCGCGGCACGAATGTTGCTCGTGACCTCGTCTCGGGAGAGAAAAAAGCTATTGGCATTG
GCTCCAGTGTGCGTAGCAACTCACGTTTGTCACGAACGGCACTGAGTACCTCAGCTGGGGTCAGCGCATGGGCATATTGTCGAAGGCCAGACACCCTGCC
GCGGCGAAGCTGTTCATGAACTGGATCATTTCGGAGGAGGCGCAGACGTCGTTGGTGACCAACAGCGTGCGCACTGACATCAACACCAACAACCCCTGGG
ACACCCCGGAGGCGAACATGGTGAATTTCTCCGCGTTTATGGAAGATCGCGCCACAGTGGAGCAGTGGAAGCAAACGTGCGCATTGTACTTGGGCGAGGT
GCAGGGCAAACCATCGCCGGTTGGCTTGGTCTTCATCCCGGTCAGTGACTCAGTGGGAAAGTGAGATGATCTCTGCATACCAAGTTAACTCGTATTGTGA
GATTTGACACTAGTGGAGCATCAAACTGAAATGATTAATAAGCAGCTTAAATGCATGTGCGGTTTTTTCAAGTGCGGAAAGTAACTTTAAAATTTCGATA
TGATGCGTTTAAGCAAACCAGTTTTACTCACCAAAACCTTCGAGGTACACCTTCTAGGCAAATTTTGGTTACACGATGTGTGGCTCGTGCTTTAACCTTT
GTTGACGCTTTTTTTTTTTTTTTTGCAGATGTAGCTTGCTTTTATGGTGGCTTTTTATGATACGACGTGTAGAGTTTTCAAATTATAGGCAATTTTTAAA
TTAGCTGAAATTCTAAATGAGAGGTCAGTTTTGGGCATTTCAAATATGATACTGGTACAAATTCTGAGAGATCCCAAGTCTCTTCCACATTTCGTCACAC
CAGCTAATCATAGTCTGGTGTACCAACATGAACACCTTCAAGGCTTCCCTGGACGACGCGTCTACAATAATTGGCGATGTGATGGAGTTCGTGGACACCA
TGCACAGCGGTGACAGCAATCCCAGCGCCACTGAGAGCTTAGGAAGTGAGAGTGACAGCATTGATGACGCCTCACACGTTGCGATGGTGAGGACGGCGCC
GGAACCGCAGCACATGTCTGCGCAGCAGAAGGCGAAGAAGCCAGACAGGCGAAAACAGGGACCAGTGCCGTACACGACGGGGCTACAGCGGCGTAAAAGA
ATCGAGCTGCTTACGCTTCGGCAAGAAGCTCAGAGGTTGAACGAACTGCTAGCTCAGCTCCAACAAAGGCGTCATGAACACCTGGCGATTGCGGCAGACT
CTACTACCGGTATTGAAGGTAGTAATGGATGGCGAAGTCTGGCGGCGATCGAGTGCGAAGGACGTGAGCAAGCGGAGAGAACAAACCGCGAGTTGAAAGT
CATATTGGCAAATCAACAGAAGACAGGTGAGGCTATTCGAAAAATACTTAGGAAGCGTGGTGTTTTGGAGGTAAGTACGGGTAATGGATGTGTGTTAGTT
GAGTGATTAGACTGATGTCCTATGCTACCAGGGTCGCAACTTTGTTTTCCAGGTGAAGCCTGTTGTAGAGCGTTTTCCATCCCGTCTCGACTACAGCGAT
GCCATTCTGGGAGATTTGGCTAGCGGTTTGGAATCTCTGCGACTGGATGCGGAAATGATTTTTCCGACAATAGACGACAAGCACTGCACGATCATCTCCC
ACAGTCGAGATAAAATGAACGCATCGAATGGGCATCACGTGGCCGAAGTAAGTACCATCACACCATTGGCGTGCTCGATGCAAAACGCGGGAGACCTACT
CTGGCGCTTTGTTAGTACCGATGTCGACTCATCTTTCTACTCGGTACGTGGTGCGTTGCTGGTTCTCATGGTGTGGTGGAGACTGACCTATTGCTTTGGC
TTCATGACACTAGATTCGCAAAACTAATCCCTACTCGTTCGAAATGAATTGTGTCGCTAAATCTCGTGATGGACCTCAAAACATCGACGGTGTAGTTATT
TATCGCCGCTACGACGAGCACAATAGCATTGTAGTCGTCGGGAGATCGACGTGGTTTTTCCCGACTGGAGGACTTCAGTTTGAAGACACAGCCTTAACAG
TAATTTCGCCATCGTCGTCAGATCCGTTGCGCTGCTGCACTGTTCAAACGCGCTATGAGTTGCAAGCCAAGATCACGGACCTCTCAGTGCTGCCATCAGA
TTTTGCACAAGTCGAGAACGCCGTCATGTCGTCGGTCGGCAGAAAACTGCGCAACGCCATGCAAGCGCTGCAAAATGCTCTTCTCAGCGAAGTGGAATTA
GGATCATGTCAAGCGCTCTTGACATGAGTGCTTCATTACTTGCCACCATATTTTACCCGAAAAACGCTACCACTGGTAACTTACGAGTAGTATATGAGAC
CCCGCAAAACAAAAGAATGCTTGTTATTAACCATTTGTTGAAGTGCGATTTGCGTATCTCTTGAGGGTCTCAAATAATTATTCCATTCAGCAGTTTCGGA
GAAAAGTGGTATTGAAAAAGTTGCCTCGGACTCGCCGAAGAAATTTCATTTTTTATTCAGATTAGTGCAAAATTTCAAACGGAATCGATTGGTGCTATTT
ATAGCGCTCAATTCACTGTCCTTCTGTGCTAAATTTGTACCTGAAAGTTTGAATTTTCAAAATTCGAATGTGTATCTTTTTTTTTTTTTTTTTTTTTAAA
GATTTTGGATACTAGAATCATTTTGAACTACGCTGGAGAATCGTAGTCGCTGGGGTATCGTAGTTGCGTTCGCCCTGACAGTTGCAAAAGGATTATCCGG
TTTCTTTGCGAGGGCGTTTCTTGGAGCGCAGCGCGGACTTCCCGTCAGGAACCTCACTACTAGCCGGGGTAGTTCCCTGGTCATCACGTCCGTCCGTCTG
TATAGCCTCCCCAGTGGTCCCAGTCACTCTGGGAGTCTCTTTTGCAATTTTCGCCGCTGCAGCGGCAGCTTCGCGCTCTCTCTTCTCCTTTTTAGCCGCG
GCTTGTCGAACCTTCTGGATTTGCTTCGCTCTGCGTTCATCCTCGTCGTTCGGCGGGTGTTACAATGGATCATTTTGGAACTCCTCCGGAACAAATGGGC
GGACCTTATTGTAGAAGGACTGGATCTTCTCGGAATTTGGGGGAGGGTTCTGCAAAGGCTCTAGGTGCATTGTTAGTAGGACGCGTACGCGAGTAGCATC
CGTAGTGATGCCGTCGTACACACGGCGAAGATCCTGGGTCACTTGGTCAGAGTCTGGACACTTACGGCACTCTACCAGGATTTCTCTCTCTCGCATCGTA
AACATTTGGTACTTTTGAATGTATTTCAGCTTCTTGTATGCTTCCTCCATGGCGTCGCGGTACACCTTGAAAATTGTGTTTTGGTTCGGAATGTGCACTG
GAGCAGACGACGAAGATGCTTCTTTCACAACACCGAGAAGCTGGTCCATTGTCCGCACATCAGCTTGAGCAATGTGCATTCGCACGTGATCAAACCCTCG
ATCCACAGCATTCTTTGAATGGCCTTTGACAAAGAACTTGAGATTGATTTCATCCAAAAGCGACGTATGTGCCCAGTGTCAGCAGCATCCGCACGACAAA
ATTGTTCTTGTTCTGTCCGCCACAGTTATCGGCGTAAATGGTGAGCTTTCGGAACCCCGCAGGAACGACGATCTGGCTGATGAAATGGTGCAGCATCGAA
TTAACTTCATCGGCACCTTTACCAGCCACACTCTCGTCGTACACGTAGTTATACTGGATGTTCTTGTTTGCGTAGAATACCCCAAACATGTTCACGTTCC
GAAGCGAAAGGAAGTACCACTGCGACGGTGTGTTGCTCACACTAGGCAATGTAAGGTTCTGACTGAAATCAATGATAATCACGGCCTGGGTGTCGTCGGC
TGAGGCAAGATCAGACTTGTATTCTTCCCTGTAAAACAAAACGATGTTAGTATCCACACGATACTGTCCATAAAACAATTTGATTCTAGCATCCATCCTT
ACCGCATACGTCGTGCCGCTGTCGTATGCTCACCAAAAGCCTCGGTCTCTGTTACTGTAGCTCCACTCTTCATCCGCGACCAGTAGATGGTACAAACGTC
TCACATGTTGGAACGTGGAGAGCGAATTCGAATAGTTGAACAAAGCTTCGTCAGGTATTGGCGAAACGTGCTTGATCTTGGTTCACGGACTCGTAGTGCT
ATCTCCTCCACGTAGTTGTGCATTTTAGTGTACAATTGGTCCCACGTAAAATACGCCGGCAAAAGTGTGTACTCTGCGTTACTGTAGTACATCTTGATCT
CTCCTTCTTTCGTTTCTTTACGTCGCACTCGCACTGACACGACATCACCCACAGAAACAGCGAATCTCTTGAACCACGAAACCAACCAGCGGAGATCTAC
AGCACTAGCTTTTTGGTTGAGAAGATTGCCATGGGCTTTTACTGAGAAAATGCCATCGTTAATACGCTTCCTGTAGCGTGTAACTGTAGCAGTCGATATC
CCGTAACACTTGCACCACGCCGTTCGACACACTTGTCCGATCAATGACAGAAAAAGGTTAAATTGCTCACGTAGGCCATGATCCCGATGACGCAGCACGG
TATCCGTCTTTTTTTTTTTTAGGACTACCAGCGTCATTATGATGCTCTGCTTCTTCTCCCCGCTGGTCATTTGCGATAGCGAGCACAGAAACTGTTCCAA
CTCCATGGCTTTCCCCTTCAAGCACTTCTTGTTGCAAGGATCCTCTTGAATAAGACGAGTGACGAGCTCGCGAAGCCCACCGTCATTCAAATTGATGCTA
GTTGCCACAGTATTGGGATCTTCGTCAACTTCACTGTCGCTTGTCTGGATCTCGTTACTGCATGAGCATTCTTCCTCTGAGTCTGGGCCCCACTCGCTGT
CTTCACTGGCGTCTCCACTTCCAGCGCTAGTGTCACTGTGGGCTTTCATCGTGAGCTACCACAGCGTCATTCTCTGTGGCTGTGTCTGCGAGCGCAGCGA
GCTCCACCATCGTGGCCTCTTACCACTGATACACCTCCTCTAAATTTAGAGATTTGACAAAATCCCTCTCCTGAATAAAATCACTTAAGTACGAAAAACG
AAGGGTCGACTTTAAAGGCGATTATCCGATTGTTTTGCGGGGTCTCATATTACCTTTTCCGCGTTTTTTTATTTTTAACCAGTGTGCTTTTACGTTTTTA
ACGTCAATGTGCACCATACTTAGTTGAAGTCGTTAGCTTTTTGAATAAAAAGTACTTTGTATAGAAAAAAGTGCGCAATGGTTTCGGCCCACTTTTGATC
TTTTTTTATTATGATGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTATTTTTTTCTACTTTTATTACTTTTTAATAAAATGGCTTTCTTACTGAAGTAGAGGTCTTGTATTCGGGGAGGGCTATTTTAT
TGAAGCTTTTAAGAAAAGGCAGTGATTTTGAACTAGGGAGCTCTATTCGGGAGATGCCCTATATTCGGGAAAATCCGTTAATAAACTCATTCTTTTTTTT
AAACATTTGTTCACAAATGTTGATGCAGTTGAGCTAAACGTATAATCAGAAGTGGTGGCGAACGTGAACACTGACTGCACTTTGGGTTTTGACATCAAAG
TGAGGAAGGCGACGATGGCTTTTGCTTGTTTGAACCCTGATAAATTGCTCAGTGCTGACCAGTTATCAGTGGTGCTGTTGTCGTCGTTCTTGGCCAGATC
TAGCCAAGGTGCAACGCTACTAAAACCAAAACCGGTTGGCACGCCCCAAAAGAAACGAATTTGCTTGAGCTCGAGTATCTGCGTGTCTTGGCGGGCAAAC
TGGAGAGTAACTTGGTGCAGCTCAGATCAAGTAAATCGGCTGCAAGTCACGAGACGGAAGCTCAAAGGGTGAAGAAGGCCCTATGGAAACCCATCGCTGA
ACGACAAAGGAAGGAGCGGATACGCGCAGAGGTAGAGAACCAGAAGCTGCGTGCAGCGGTGAAAAGCCAGTTGAAGCTCGTGACACGTCTACAGGGACTA
CTTCGCAAGCGTTTGAAAGAAGAGGTTAGCTTTTGAGCTCCGGGCGAATTTGGTAACTGCAGCTAACGATTTCCCTGTTTTGTGATGCCACAGGATGTCG
AGAAGCTGGTTGGACCAAGGCGATTACTGTGGGTGCCTCGTAGCTGGAGCTTGACGGACAATGAAATATTCGCGGATCAGTTGTTACATGTTCAACGAGC
TCACCTCGAAGTGGGCCAGCTATTTAGTGGACCAGATTTCGAGAACACTTTCTCAACTTTCAGTAATATGCACGTGGTGTCGGATAACAGTTCGGATACC
GGCGTCGCTTTCGTGACCCGGTCCAACGCCGTATTACCCTTTGACGTAAAAGTTACGGAAAGAGGCTTCTGGCGGGTTTTCGCAATGGAAAGCATCGCAA
AGACCCGATATTTCAATGAGAAGGGAATGTCAACGGAGAGCGTAGTGGCGAATTCGTACGGGCTGCGCTTCAACGCTGGAAATTTTTGCGGCGATGTGCT
AGGCAAGCAAACGTATCGCCGATACATAGCTGATGACTACATCGTGATCATGTGGAAGTCGATAGTTGAGCCAGGAGAGATCAATGGCACCAAGTTCTAT
GGGCTGCGATGTCACCAAAAAGGTTGGCTCAAACTTCGTGCAGTCCACTTGGTGAACGGCGTGGCTGGACCTATGACATCAACTGCACTGCAGACTTTCT
CAAAAATGACAGTGGAGCTATGCGGCGACATTACCGATCGAGATCTTCAAGCTTGTGCAATCACCGATTTTATTGTCAGCTCGCATGAAACAACCACAAA
AGTCTACGGCGGAATGATTAACGATGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGAAGGTTGATCTCCACCAAGTTGGGCATGTTCTTG
ACTGCAGCAGCAATAGCCTCGCCTCCCTGGGCCTTAAAGGTGTTGTCACTCAGGTCGAGTTTCTCGAGCTTCGTGAGCGAAGCCAGAGCCTTCGCAAACG
TCAGACTTCCCTCCCTCTGGGCACGCGTGGCTGAGAATCTCAGGTCCTTGAGCGCCGGCGACAGTGGCAACAACTTGGCCAATGCAATGGCGCCGCCGTC
GCCGCTCATGTTGTTGTAGAAGTGGAAGGTCTCGAGCTTGGTGGGGGTGTCCTGACCGCGGAACAGCAGTACCTCCTCGGCAATGACGCCTGCAGCCGCA
GCCGAGATACCGTTGTTGCAGAAGTACATGTGCTGCAGCTTCTCCTGGTTCTGCAACAGACCGAAGCAGGCACGCACTCCCTTCTCGCCTAGAGCGTTGT
CGCTCAGATCGATGCGCGTCAGCGACTTGATGGCGCTCAGCGCGTCGCAGAGCGTGGCCAACACCTGCAGCGCCTCGTCTTCAGGGCGGCCAGCAATCAT
ATCCGCAAAGTCCACGCTCGTGAGCTGAGCGAAAGCGCCGCGTGCCTCCAGACGCGAGAAGAATGCAGCAATCACATGAGCAGCTTCGATGGTGTAGCTC
TTGTTGCGCAGCGTGATGTGCGTGAAGGCTGGCGGTTGCGCCTCTGAATTCGCGTATGTCTGCACCAACTCGTGGGCGCGCACCTCCGTCACGAGCTCGC
GCTCACCCTCGAAGGACAGCACGGTCTTGGTGGTCGCCATGATCAAGGAGCTCTCGGGGGCAGGGCACTTGGCCTTTGTATGGGAAATGAGACGAACTTG
TGATTGGGTGGATGTTAGTGTCCCCTTTGAAATATGATATCGACTTTGCTTGGCTGACGTTTTTTTTGCATTAGAAATGGCTACACATGTGGCGATCTTC
TGCTTGCATCAACGCATCTAGTGGTGGCTGTGGTGGCATGTGTCCGTGTTACTCCTAAGTTATCAAATCCATCAACGCACTATGCAAATGCAAACTACTA
ATATATCCGGCCGCATCCGCCGCTGTGCCGCGGCGGTGAAGATCCTCCCTTGCCTACCTGTCTGCCGGCTCCAGGACTCCCTTGACGGCTGGCACCACGG
CGGCAAATGACAGGTACATCCATGCTTCAGCTTACTCGAAATACGACTGCACTGTCTCCTGCACCTTCTCCGCAGTCTGCCGAAGGGTGGACTTGATCAA
CGACTGAGTTTGCACAAACGAAGCGCACGAGAAAATCTCCTCGGAGCCTGCAGCAGCAACAGGATTACACGTTCAGCAATTAAAGGTGAGAGCTAGATCC
ACAAAAAGCTGTACAAACCAGGACAACGTACCCTCTGCACTCTTGGCATCAATCTCGCAGAACTGGAACGTCTCCTGTGACCAGTCGATCGCAAAGAGAA
GAGCAAATACTAGCACAATAATTGCCACAATAAACAGCGGCGTGTACACGAACACCCGCTTGGTCCACGTTCGATGAGTTTCAGCCGTCTGAATCGCAGT
CTGCTTATCGAACTCCTCTGCCTCTTCAGCAAGTGCTTGAGTCTCGCTAGCGTCAACTTCAGGCAGCGACACAGCGTCCGACTCCTCACTCTCCTGACTA
AGACGTTCCTTTGGTGCGAAATCCGAATCGGCCTCCGAATCACTCGATGTCTTGATCGTGTTGATGCTCTCGCCGCTAATACTAGGCATGTACTTGGCAC
GCTCACGTACGCGTTGTACGTCATGCTGTTGCTGTGCCACAGGCGCGTAAATGTCCACCTTATCGTCCAGACCGAGCTGCTTCACGTGGTAGTTGGTGGT
GGGTCCATCCCATTGGTCCTTCTCGTCCTCCTCTTCCTGCTCCTCAGCGGGAGTAGCGTCTTCATCAACATTCTCTTTCTTCTCCACTACCTTTTCCACC
GTCGTAGCCGTTGTGGTCACCACCTTCTCTGCCGTCTCACTGGAGCATCAACAATACACACTTAATCCGTCAGCCTCTACCTACATCCTTCTTCTTCCTC
TATGTAGCGTCCTACCGTAGCGCATTGTCCGGCGGACTGGCAACCATCGTAGAGCGAGCTACAAACTGCTGCGTGGACACAGAGCGCGTCGTGGGTTTGT
TCTGCTGGTCAATATCCTGCTCGCGTTCAGGCTCGGGCATAGCAGAGAACCTGTCCACCATCCTACGCGCGATCGAGTTCTTCTTGTCCACCTGGTCACT
GGCCACGTCCACCACCGTCTTGCTCTTCTTGCTACGGTGGCCAGTGTCGGGCGAGCTCAGGCCCTTCCGCTTTCCGCCTTCTTTTTTGCCGGTCACGCGC
GCCACGGCGGCGTCGATGCGCTTCTTCTGCTCCTGCGCCAGTGCCAGGCGCGTGGCCTCCAGCTTAGACAGCTCAGGTGCGCTCTCGCCGCTGTTGAAGC
TCATGGCGGCGTTGCTGCGATCGGCGATCTGGGCGGCCATCTCAACGTTGCTTTTTGTATGGGAATCTCGTAATGAGGCACGAGCTTGAACTTTCGGGGT
AGCTTTTGAATTTTCAAACCGAAGGGCAACCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGATCAGTTGGGGCGTCAGATCCACAAGGCGACTAAGTCGAGTATTCAAGCATTCTTGAAG
CGGCTTCGTGTTGAGCTGGAGGGGTTCATGCGATTCGAGGCTCACATCGCGGTGCACGCACCACCAAAGAGCAGTACTAACTTTCCGCCGTCATCTACAT
CGACCGGACCGGAAAAGAAGGGCCCGCGAGGAACTGGAGGAGGTAAGGCCACGTCGAGCGAAGCTAAGCTGGCGACGGTGTCGTACAAAGCGAAGCCTCC
AGCGTCATCTAAGACAGAAAAACCAGACAAAAAGTGTTTTAAGTGTGGCGATCCGACCCATGGTGTTTTCCAATGCCCGAACATTGCTAGTCTACTGGAG
GCGAAGGAAATATACGAGAAGAGCGCTGAAAAAAAGGCGATGAAGCCCGTTTTGGTAGCCACTTCCGGGGAAACGACGCAGGAGTCGTCTGCATCGATTC
CTTGCCTGGTGATGGGAGCTGTGGAGACTTTAATCACTCCCGACAGTGCCTCCGTGTCTCTAGTGACAATGAAATTGATTAACGACTTGAAGTCGGCCGA
AGGAGAGGTAGAGATGCAGCCTTTGGCAAAGCCATCAGGCGTGACCGGCGTAAAGGATAAGCCCGTTCCTGTTAGGAGCAAAGTGAAGCTAGATCTGCGT
TTTACGACTCCAGGAGGACCCTTGATTTTGAGGAACGTAATCTGTTGGGTCACGGAAGACAGTCTTCCGGCTGGAGTTGGCGATTTATTGCTCTCGCATT
ACATCATGGAGCGTCTAGGCTACAGCTCGAAAAAATTGATTGCAGCAGCTCAGAGTTTGCAGGAAGTTTGGGATATGGGGGATGTTGAAGACGATTGTGA
ACTGGGTCTCTCATCGGTTTTTGCGTACTCTGGAGTGCCTTCGGCGATCGAGCCGACAGTAGAGGAAATCCAACTGCACGACGACGAAGACCATGCGTGT
TTTCCAAGTTTCGACGGTGCAGCCCGATCGGAACATGATGAAGTGGCTGCGGTTCTGGAAGAGAAGTTGGCGGAAGTTAAAGAAGCGGGAGCGTCCCGCG
AGTATGTAGAGCAGCTACGAGTGGTGTTAGTGAAGTTCAAAGACGTGTTCAGACTGCAAATCGGGAGGGATCCCCCCGTTGACATGCCTGCGATGAAAAT
AACACTGAAACCTGGCGCAGTTCCCGTACGGTGCCGGGCTCGGCGCTACTCACCAGGGCACCGTGAGTTCTTGAAGAAGCATATAAGTGAATTGCTGGAA
GCTGGCTTGTGTTACAGGAACTCTCCGAGTAAGCGGTGCTCACCTCCGCACATGGTGCGGAAGCCTGGAGTGGGAAATTTCAGGATGACTGTGGATGTAA
AAGTAAAACTAGCAAATGAGAAAGTTGAACAGGTCGTGTGGCCGATGCCGATTCTTGAGGTGGAATTTGATCGCCTACGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGGACGTTCCGGTCGCTGCCAAGGCATTTGAGCGCTCCCACCAAGACGA
TGAGGCTGTGCAAGCCATGAGTGCCGCACTGGGCCTGTCTCTGTAGAGATACTCGGTCACTGGTGTCAAATTGAAGTTGACTTGACCTGGTTGCATTTTT
CCGGTGAGGCAGGATGGATACATTGGGAGTGACTCGAAGCTGACACGAAAGTGGCGTAGCGCCACACTGCATTTTACACACAGGCTTCACAGGGGGGAAG
TGTTGTAGCGCGGCAAGCGCTAACAAGCGCCATGGCAGCGGGGGTTGCAGTCCCAAAAGCCACGGCGAATGAGTTTCGAAACGAACGAAGCATGCATAGA
GTAACCACGAGTTGTAGTCGACCGCAGGCTAAGCTAATATACTCACTTCTACATTTGATCAAGGGCGACAAACAACAAACAGCTTGGTGGCAGCAGGGTG
CTTTGCCTTCGAAAGGATGCCGACACGTTGACCCCAGCTCAGATACTCCGTGCCGTTACCACCCACAAATTTAATCGGGGAGCTACTACCGCTGGTCCCC
ACACCAACCACTTTCTCGCCCGACTTGGCAAGGCTGCCTGCAACATTCGGACCGCGGTTGAAACTGATGTTTTGTGCAGCCATCTTGGCCACCCAGTCCC
AGCCGTATGCCTTGGTGTAGCGCGTGTAAAGGAAAAACACAGCATCGTCGTCATTAGAATATGACGACGCAATCTTGCCAGCCCACTGTGGATTCGCCAG
GTCGGTAGGACTGGTGGGTGCAGCGAGACCGTCAAGCGCACTCGAGTTATAGATGTAGCCGAATGTGAAGAGTTTGTACGCCATCCAGGCACCATCCGAG
TCCCTCAGCGACTCGTGGATTTTCGAGAAATTGGTTGGCTTGTACTTGAGAAGATTACCGGCGCTAGCCCAGCGAGGAAAATTTTGCAGCGTTTGTAGTG
CCACAAGATCTGGCACCAGAGTTTTGGTCTCCAGCTGATTGTCGATGAGCACGTCATGGTACTTGCTGTAGTCGACGATGAGAGTGAAGTTAATTTCCGG
GAAGCGCTCCGAAAATGCTTGCTGCAGATTATTTTGCTTTGTTGGGGTGTCACCTCCGTGGTGCATGACGAACTTGCCCCCTTCGGCTACAGCGGCAGCG
TACAGCTCGTCAATGGACTTTGTCTCTTCGCCGGATTTGGCTACAGTTCCGGGTGCGAGCAAGGCGAAAGCTGCAACGATCGTGGTGAAGAGCTGCACTG
GTGTAGATTATTGATATTGAATTCAACTTGAGGCGAAGGGAGTAAGTTTGAGAATGCCAAGCTAACATATAATTAAAGTCGTTAGCTGGTCTACAAGGTT
GCTACTAGAGGGAAGGCAGCTTATTTTACGCTATGTTCATACCTCTCATAGGTTGCTGTAGCCTACCTGTTCTGACTGCTGGTTGGCTGAGGCGGAAGGG
GTTGAGATCTGTGCATCAACTAGGCCCGTTGCTGCAGTTCACTCTTCGTGACATGTTCTGCTCGGCGTTGATCCCGCAACCGATCATTTCCTCTATTCGC
TGGGAACAGGTGGTGGGCGATAACGTCATCGTATCGCGGATTAAATAAGCTAGCCTATTGAACGCTTTGCAACTCTTTGTAATACATGTACAGACGATCC
CTTCGGTAGTCATCGTGTTGGGAACCCACAATTTATTCCTGTCTAAGGGTATTCCTATTCACGAATGTACCATAAAATGGTTCCGAGTACCTTTGGTTTG
GAACAGTGCAGCTGCCAAACTATACAAGGTAGGGATTCGGCAGGCAAGTTCTTGGAACGCTATGCCACCGTCCCTAGGTGCTGGAAGCGCACCCGGCTTT
TTGACTACTACAACTGCGTCTACGAAGAACCAGATGAAGATGATGCTATGTCCGCCAAGCTCGCGACGATGTTATCTCGTCTGTACATTAAGGACCCAAT
GTCCGTGGACGAGCTTCTAAACCCGCCGGACGAGAACACAGCTGCAGAAGATTTCACACATGAAGACTTCTGTGGAGTTGGTGACCAAGAATTGGCTGTA
GATGGCTCTGATAACGGCTCAGAAAACATGGACGAGGACGATATGGAGCGTTGTACGTGGATTGAGGAGGGCCTTGAATTAAAGAGCATCTCATGTGGAT
CGCTAAGCTTCTCGTTCGTGCAGGTCCATTGTGTTGGCTTCACCACACGATCGCTGCTCATGACCCTTTTAATGGCATATTGCCCAGCACCTTGGCTTTT
CACGTCTCTCCCCTTGGCCATTTGCTGGATAACGAAAGATCGAAGATGCTCATCGACATGCAATAGAGCCGTAGCCACAGTCGTTTTCTTGAACTCTTCC
ATTGTTTGTAATAACCTCGTTTCTAACTTCTCGTGAGCGGCGTTCTCCTCTGCGTAGTGGCGTCGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNACCGTCCAGCAGACCGTGAAGAACACGACGGCTACAGTTCCGGATGGCGCGCGGCCTGACAGCACGGGCTCTATGCTCTACAAGAAAC
CGTACATCGTCAAGGCTGGCGAAGTCTTCGATGGCTTGATGAAGACGTACGAATGCTCGGACATCACATGCTCGGGAGGCGAGGGCCAGAAGGACACGGC
TGCGCCCTCGCGGAGGCATCCTGAACAACGCCATCATCGGCAAGAACCAGAGAGAAGGCGTGCACTGCGACGACCACAACTTCACCACTGAGAACGTCGC
TATAATCAAGCAGCTTTGTATGTGGCGTGTAATGCGATGAAGGTTCGTTTAGAGGGTGAATTACAGCTCGAGGCCAACTTCGGAGGCTCATTTGTAAAAA
AAAAAAAAGAGGAGGATCTAACTGCGTGTCCGAAACACTAAGGTAAATCGAATTTGGAAACGATATACACCAGCACAAGAACATATTCGATTCATTAATC
ACATATCAATATCCGCCATAGAATTTCCTCCGATATCATCTTCATTGTTTACTAAGTCTTCGTCATCGTCTCCATCACGCACATCCATATCCCCATCGTG
TGCGTCTGGAAACATGTCATCCGCCAAGTGATCTCGAATCGGTTCGCCTGTTCTCGAGGCTAAGTTTGAGTAGACAAAGACAAGTTTCTCTACTCTTGAT
GCATGCAGTCGGTTTCTCCTCTTTGAGTGTATGAAGTCGTGAACGCTCCAACACCGTTCACTTGACGCGGACGAAGTTGGGATTGAAAAGATCATGTCCG
CAACTTGCTTTAACAGTGGAAATAGTGCACGGCCGCGAATCTTCCAGTAACTTGAAGGAGACATGGGGATAGTAGATGGCGCTATTCCCCTTTCTGCCAA
TGAAAATCGCTGACATGCCCAGGCCTCAACCGCGGCTTCATATTTGTGCACTGTATCTGGGTCTGTTGCATCCCCTTTAGCCATATCAACCAATTCGCGC
ATGGCTAATGCGAGATCACCTTCTTCGCTTGGATCGTTTGCGTTAGCAAACTTGGTGATATCGGTGGTCTGATCCAGTAAGTAGGCAACTCGCATGGAAC
TTGACGTGATGAAGTCACGGCTGCTTTCAACCAAATCCAAGATTTCACGCTGAATCTCACCATATTGGACCCTTTCATCCACGCTGACTCCGACGACGGG
CATACTGTAGGCTGCGTTCTCTTTGAAGGCGACGAACTCAGAGTAGACGGACGACAGGTAAGTGCTGTCACTTTCACATACAGCCAGACTTTTGTTGATT
GGCGCTAAGAGGTCCAATGTTCGTTTGGCCCCAGACTAGCGTTCATCGTCAGCAACAATTGCTGCAACACGATCTGCCTCGGGTCTCTGTGCCTTGGTGT
TGTACGGTTTCAGTAGCTGGGTGTCAGCAAAAATGGAGCGGATAACAGTCTCATTCCTTGATACACTGCGAATACATTTCTCCACAGTGTACCAGCGTAT
TGGGATAGGAACACTTAGCGCCATCCTTCTCTCGCCCTTTTTCAGGATAGCCTTCTGCTGCGATCGAAAGCGATCTAAAAGTCCATGCCTCGCGCGAACA
AACTTCGCCACACTTTTGGAAATGTCACGAACGTTAGCAAGGCGGTTTATTTTCATGACATCTTTCATCAGTAAGTTAAATGCGTGTGCGGCGCATCCAT
TACAGTAGACGTATGGCCTCTTTTATTTCACTTGCTGTCATGCTGACTTCATGTTTTTTGCATTGTCAGTGACAACAGCGCAAATAGCCCCCTTCCTCCC
AATT