Description :
From Genome Similarity Track
Location :
Scaffold_1783:2920- 4221
Transcript NameFunction/comments
Phyta_totarag13653hypothetical protein

Sequence
1301 bases(100 bases per row)
TTAACCATTTCGCGATACGAGGGCGCATTTATCGCCCTTTAAGGCCCCTCTCAAAAGTGGAGGGGAATTAGGCTTCTAAAGGGCGAAAAAGGCGCCCTTC
AAGCCTTGCAGCAGTTTTCGCTTACCTTGTTTTGTTACTCCCAATCAAAATATAATAGCTAAAAGAATTAGGTGTATTTTGTGGAAATCCGTCGGTTAGA
TTCCTTTTGGATCAGATAAAAAAACGTGTGTTTTCGTAACATACCGTGCCACGTCGCCAATATCACGTAAATCTCAGCCATAAAACGTGGTTTGCCAATC
TTGGTTTTATCTTTCAGGACTGATTTATACCAAAAACCGTGAGGTTCCCATTTCAGTTTTGTCTTGCAGGCCACCCATTACACATACGACGGCCATATAA
ACGCGTAGATGTATACACCACTGGTGGTCATATCTACTATACAAAAGTTAAGATGCATGCACTTAACATTTAGTTAGTCATGCGTACTAGCTTCCAGGAC
TGGGAGAACAAACTACTTGTGCAAATGCACCCCAGTTTGAGCGCGAAGGCTTACGTATAATATGGGACTATGTGGCGCGGCacgccagcttcagctaTGT
TTGATCAGCCTCAAGCGAACGTATGGGAAAGCTATCAGGAGCTTTCCACCATGCTTCTTTGGTACTGTCATGCCCCAATCGATCTTGTCATCCTCCCGGT
CGGCATTACCACGACCGGCGTACGCAGCGAGTCCGATACGTGCGCCGCCAGCGAGGGCGACATCTGCGGCTTCAGCAAGtccgacaccagcaccgtCAGC
GAGACCGACATCTGCGTCGTCAGCAAgagcaacgccagcaccgTCAGCGAGTCTGATACCAGCACCATCAGCGAGACCGACAGCGAGACCAACACCGGCT
CCGTCAGCAAGACCAACAGGTTCGCCGTCAGCAAGACCGACACCTGCTCTTAGATGGCAAGCGTCAACAACTCTAGTCCTGCAAAGCGCGCGACCTGTGT
ATCGTGGTCCTTTACTTACACTGcccgaagctgcacgagagATGAAAGCCCTTTTTGGCGATGTGAGCGCAGATAATGTGCGCCAACAGGTTGGACGAAT
GCATGCAAATGCCGGGGAGGTGCTTCCGTCTGGTGTCGCCGAGCTGATTCAGGCTATGGGGCCAGTGGGTGGCCAAGGCGTATTCCTCGATGTCGGTACT
GGGATAGGTAACGTCAATGCACAGATTGCGCTTACCACCAATTTCAGTGCATACCTTGGCATTGACGTACGCGCTGAGTTGTGTGCACTTGGTGAGGAAC
G