Description :
From Genome Similarity Track
Location :
Scaffold_1629:292- 4100
Sequence
3808 bases(100 bases per row)
GTGGTCATCGCTGCGAAATCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCA
AGAAGGATTGCATCGCCCGTAACGACTGCGGGAAGGACAAATCGGCTAACGAAAACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAACTCGATG
GCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTTTCG
CACAACTGATCCCACGATTTCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACGGACGGGGTTCCAGGATCCCCTGGCTCTCCTGCCT
CAAATGAATCTACTTCCGTATGATCTTCCCCGGATCCACCACTTTTGGGTTCCGGTATTCGGGTGAATCCATAGAGAGCGTTATCGATTAGACGTTGGTA
GATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGGATATCGCGCGAGCTCACTCCGTCATA
GTAACTACCCAAAAACCGCTGACCATGTCAAGAGAGCAGTACCAGAGTACTTTATCCAAATCTTCCAGCAGCTCATTGATTAGAGGCATCGGATACACCA
TCAATCGAATCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGA
CGTTGAGAAACTGATGAGCTTGGCTTTGCAGCAGGCCCTTAATCAGATCCGATAGTTTTTCTCGGGAGCTGAGGCGCCACCTTCCGCACCCTCTGAGCGA
TCGGTTTCGCGTCGCCGACATCGAATGTCACATTTGACTCCGCGGGGCAGCGGGACGGGTAACGCATTACCTTTAACAAATCAGCAGAATGTCGGCTCTC
CCCAGATTTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCCGGATCCACTTGGATATCATCAATCGTGACCTCCTCGGTGGTCAGTGGTA
CCTCCGGGATTACCGCCATACCTTCTCCAAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGTTCATCTTCGGTCTTTGTCTGATCCAC
CCTTGGATCCAGGCACCGCGACTCTCCTTCGACCGTCATCCCTTCTGTCTTCGTGGGGTCGGGTATCCTGGTACTGGGGAAGTCACCTGTCGGATCCAGC
CGGTCCTCTAACGAGTCTAAACCCGACGGTTCGGGTTTGACTAGCGTTGCCGCTCTCGATAGGGATCCAGGCACTTTATCCAGTGGAAAGCTTGGATCCA
CTTGTGGATCGGCGGGATCCGGCTGTTCGGCTTTAGCCCTCTGCAATCCTTCGTCCACCGACCCTGCGTTATCTAAGGGCCGACTCGGGGGATCGTCCCC
CGTCGTGGATCCAACCTCCATTGCTTGGATCTCAACCCGTCGATCTCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCA
GTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTCTGTAGCGGCGGGATCCCACTG
ACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCCAACCATCGTCCGATCTCTTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGAC
CTGGAGGTATTGCGATCGACCTGGTCCTTGGACTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTCAACCGG
TCTGACAGCTCCCAAGTTTCCCCGGGCTCGATCCAGGTGGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGAGCT
GGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGATCCAACCTCACTCCAGCTGGCACCATGAAATCCATCCCAAGGATGGCGTCTTGACC
AGCGAGATCCCCGACCCAAATGTCAAACCAATACACCAAACAACATGCCAGCGTGATCTTAATTCGCGTTCTCCCGTTTGTACGGTATACGCCTTCACCA
ATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGAA
GTAGGATTGCTTTGCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTT
AGCAGATCCATGGATCCAACATCCTCAGATCCACAGGATCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACC
ATCGACCATGTTGGCGTTTCTCCCAGTAACCACGTGTCTCTCCTCTTTGTAGATCCAGGGTTGAAGAGACTTTGGATCTGGAAAACTCGTCCACTTGGCG
CAAACTAGAGACCCTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGTTACCTGGATTTAGCGATGTCTTGTTCACA
AATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCTGCCACTTCCGGCAACATCCC
TCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATCCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACG
TAGAAGCAATGATCCCCGGGATGGCCTTTCTTGCCACACTTCTTACAGACCAGGTGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGTG
AACACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGGTCTGTACATCCCATAGTCCCCGGGTACGGTATCCCCCGGTCGAGAGTTGTCTCCTGTCCT
CGCCGTTCGATCGTTGGATGCAGTGAGACAGACCCGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCC
GTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAACCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGC
GATCCACCGCCCGCAGCACTTCCTCAAGCTCGTCTGCGTCGAGGAAGTCGTAACAGGGTCAGCCTGTCGCCAACCAGTTCCCAAGTTGAGAATATCCGGG
TTCCCGCATAACTGAGTTCCCCCCTTTAGTTTTTTTACCAATCGGGACCCTGAGAAGGCGCCACCCTTTAATGGCGGGGAACAATTTTTCCCGGCGAGGA
TTTCTTACCATTTGGCGGCGATCGGGTAAAATAGGGGGTTTTGTGGGACTTGTCACCGACACCCCCAATCCACAGTACTGGGTTTGGAAACTGCGCAGCA
AATCCGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGACCCCGCTAGCAGATCCGCAAAGTTCAAACACTTCTCAGCATC
CGACGCTTGATATCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCGCGCTCGGTCTTCGTCTTGATCCTTACCCGTGAACTCCTTCAGATCCGAT
ATAGCTGA