Description :
From Genome Similarity Track
Location :
Scaffold_7:292- 3377
Transcript NameFunction/comments
Pytar_ATCC12531fgenesh_masked-par_contig_7-abinit-gene-0.69Ubiquitin ligase E3 alpha-I

Sequence
3085 bases(100 bases per row)
CAATGGAACAGCGCAAGGACGAAGCACGGAAGCGAGCGTTGGAGGCAATGGCTCGTCAACAGGCTGCTTTCCAAGCAATGATGGCCGACATAGGGGATGA
AGACGAAGAGGATATGGAAGCTGAACCTTCACCAGGTGATCTTAATGAGGAAGGCAACTCGTCGAGCACACTCGGCAAGCGCCGAGCTTCTGTGGATGAC
GCGGCCACCGATGTCGAGGATTCAAAGCGGCCTCGTTTGTCTGATGCAGCCCATGACGCAGGCAGTTTGTGCTACAAGTGTATCCTGTGCCACGACACGG
CGACACAAGGAGAGATGGGGATGGCAGCTTACGTTCACCAGTCAACTGTCCTCACGGGTTCATTCCGTCCTGATCCAGAGGAAGGGCTACAACCGCGTGG
CACCGAAGTCCGTAAGCAGGTCAAAGCGCTGATCGAGAAGATGGATTTGTGTTCAGGTGGCCCGACAGTGTCGTCGAATTCGCCGTCGCCCGCGCTCCGT
GCTCTCGCTGCTCAGTTTCCAGACTGGTACATGGATGACGGGTTCGACGAAGAGCTCATGCTAGATCCCCCCATGCCGCATCTAAATGCAGTTGGTAACC
AGCGCCAGATCAGACACAACACCGGCACGAACGCTGACCAGAACGCTCGCAACCAGCGGCGACGACCTGCAATTGAAGCATTCTTGATGGGCCAAGACGA
AGACGATATGGAAATGTTGGAAGGCGTGCTTGATTTGCGTGAAGACCAGCGGTTGTTCCCGCTGCCAATCCTGGGTGGAACAGGCGCGAGCCCGGAACGT
CGTGACCGTGGCGTGCGTCGACCTCCTGGAACAGATCGAGGCATTGTTGTCGCCAGACGAGGAGCTCCAATGCAGGGCGTGGAAAGCGATTTCGATGACG
ACGACAGTGACGAGTATGACGAAGACGACCATCAGTTCCACCACCACCATCATCACCATCACCATCATCACCACAATCACAACCACAGCCCTCGACGTCC
GCGCAGCCATTCGCGGACGGCCAGTGTGCCCTTGCACTTAACGCCATGTGGACTCCACATTCGCACGTGTCAGCATGCTGTGCACATCCACTGTCTCGAG
CGGTATATCCGTTCACTCCACGAGAAGGCGATTCGCGGTGAAGATTTCGACGGGGTGCAAGCCATCGATCCGGATGCGGCCATGACTCAGTTCCTGTGTC
CGCTGTGCAAGACCTTGTGCAATTTCCTCATCCCGACGTCGGATCCGGGTGGCAACGATCCACGGTTGGCTATTGCTTCCCGAGGCGCCGACCCAAGCGA
ATCGTCTTCGTCTTGGTACACAGTCGTTGAAAGACAGCTTAAGGTGCCGGGTTGGTATCGCGCAGTGCTTGGTCGAGATGGGGACTTTGGCGATGGCGAC
AATGACGCACACGATATGTGGCGAGATTACTTTGAAGAAACTCTGTGGGAACCGCATGGCAGCCTCGAGAAGGGCGCTCCTTTCCTGTGGTCGGCGTGTG
CGTTTTCCGTTGCTTCGTTCTTGAACGTCGCAGATGAAGAGTTTGAAAGCACAAGTTCGTCTGCTGACTTCGACCCGCTCACGCAAAGTTGCCCGCCGTC
AGTTGAGAAGGAGTTCACGTCGTTGATCGCGGTTACCAAGTTTTGTCGGTGGTCCTTTTCGCTGCTGGAGCACAGTGAAGATGCCAAGGTGATATGGGAG
ACAGCCAAGCGCTGCAATCCGATCAACACCGAAACGAAGCGGGAGTATCGCAAGTTCACCAAGGTCCTGGGCTCGATCGATGCATGTCTGCGCGGAACCA
TATTGGGTCTTCTAGTGGCCGACACATTTACGGCGTTTGTAATCTCGAGTGTGATTGCAGACACGCCAGCCACGATTTGGCAATGCATCCCCGTCTTCGG
CGCGGCCGATTTCCTCCAGCGCGTGTACACGGAATTCTTCGTGCAGTCCAAGACGGATGACCGCTCGCTGCTCCAAGACAAGTATTCGATTTTGAAGGAT
TCGTTGGCGTTGGATGCCGCGGCAGACGCAGTTGTCGAAGAAGTTCCTCGCCGCACTCGCCGAAGCAGCCGCCTGGCGATCCAGCCAGACGTTGTGAGCC
CAGCTAGCGCGAGTTGGGAAAGCGAACACAAACCATCCGCGACCAAGTCACCCTCAGCCAAGGAGGTGGTTCGAGCAATGCAAGAGAGTGAAGTGAACAA
AAACTCGGAAGAGTACGCGGTGCTGACGCTGTTGGCTCGAATCCTGGAGTCGGAACCCGAGGAGCAGCTGAAGCCACTGACCAAGCATACGGTAACTACT
CGTCTGCAGCGCATCAAGACGTTTAATGGACTGCTCGTGCGACGAATGAAGCTGTTTTACCGCTGCCTCGCGGAGGAAACGCGTGACCACGTCCTAGACC
CGTCCAGCGTGGCCATCCCGAGTGCCACCGACATTGCCGCGAGTCCAAAGCCAGTGTTTTCGCAGATCTGGAAGTGGTGTGTCGACCGCATCAAGAGCAA
GAGCTATTTGGGCAGCGCCAAGGACGGCGACAAGTGCGAGCACGCGGAAGGCTGTGGCGAAGGCTACATCGCGAGTATGTTTATCCTGCGTGATCAAGTG
CGGAAGCCTCGACTGATTGAGCTGCCCGTGCAGTACGACGAGCTCTACGGTACGATGTCGGGCCGCAAGTGTGCGCGCTGCGATAAGACTCCGTGCGACC
CCGGCATTTGTCTCCTCTGTGGCGAGTTTTTGTGCTGCGGCGACGCGTGCTGCTCGCATCCGTACGTGAACCACGGCCCACAAGTCGGCGAGTGCACGCG
CCACGCGGCCGAATGTGGTGGCGGCATTGGCATCGTGCTCATGCTCGACCAGTGCCGTGTCGCGATCATTGGCGGCAGCATGGCGGCGCATTTTCCGTGT
CCGTACGTCGACGCCCACGGCGAGGAAGACGTCGGGCTCCAGCGCGGGCGGCCGCTGCGGCTCGATGCGGCACGATACCGGTACTTGGAGTCGCTCTGGC
TCAACCACCGCATCTTCGCCGAGGTCTCTCGCCTGCGCAACCAGCGCGAACCGCAGTTCACGATCAACCTGTCGTATCTGTAGAC