Description :
From Genome Similarity Track
Location :
Scaffold_132:29197- 35219
Transcript NameFunction/comments
Albla_Nc14078850
Albla_Nc14078860phosphatidylinositol kinase (PIKL4) putative

Sequence
6022 bases(100 bases per row)
TGCGTTATTTATACAGGTATAGGTGTCCACTCAGATCTTTATTTCCCAAGACAATCGCTTACAAAGAGTCATACGAATTACACCAGCTGCACCAAGTTAG
TGGCCAATGTGTATATACCCTAACCGAAGGGACAAGGTATGCACCTATGTTGTGTTTATCCGCCGGTTGGTGCGTTGTCTACTAGAAGCTGGAAGGTTGC
CATCAAGCTCCGTAATACGAGACTGTGTCGTGCATGAAATACGCGCAAGAGTGGCACTTTGAGCAAGTTCGTGCAACACTGTACAATACAGAACGAGTTA
ATTATCACATGGGCCAAGTGGTGTCGTACCAGCTATGAATTCTTGTCGGGTTTGTCGAAGTTCGTGCGGTGGAAGGGCACTGAACCAAAACATTGGATCA
TCATGCAACGGAATGCTATCAGCGCCGTCAGTATTCTTTCGTTCCGGCTTGGTCAAGCTATTCTCCTGCACTGCAACGATTTCGTAGCCACCAGTGCTGT
CAGCAGCGTACTGGATCGCGTTGAAAACCGCAGGATACGAGATACTCGACAAGTTATGGGCGGAATGTCGATGTTTCGCTCGTGAGAGCTTCAGGAAGCA
CTAGGGATCGCATTTCAGTGTCAGAATAAAGTCTTTAGCATCCACGCAAACCTTCCTTTTTTAGTTTATTGCATGCTTTTTCGTGTTGCACAAGATATTG
CTCGTAATGGCCGATGGTATCGACCAGGGATTCGTCCATTTTAACTAGTTTTACCGTATTTGACTTTAATAAGGACCCGTCAATCGTGTTAGAATGTACG
TCGGGTGCTTGTCGGTGTTGGTGAAGCTCATTGCATTGATGGAAAACAGATCTACGCAACACAGATAGCGCATAACTATGTCACATAGTTCACGACCGCC
TTGACACCATCGTGATACGCGATCAGAGACCAGAAATTGAAGCGGTCATGCAGCCAGTGATATTGATATTTCGGCTATTTACATTTCTCATCGGCCCGTG
AGAAATATAGACCATCACTCTCTCATTAGAATTTATATCAAGAAGCTGGACCAAACATCTCTTACACCTATCGTCCTAATGCAAGGTAACCGTATACATA
CCAAATGAGTGTCGAAAAAGAGTGGTGTCGATACAGCGAGGGGTTCTATCCACTTCAAACAGTACATCAGCACTACTTACAACAGCGGTAGCGGTTATCA
AAGTGTTTGTAAGGCGTACTCTACTATCATCGTATGTAGTGGTCAAAAAGTGCGGATAGGGACATCGATTCCTCACTAGTGCGTACTCACCATCAGTATT
GTCCAATGGTTGCTCAAGTCATACAAGTACCAATCCACCCACCGATTACCAACAGATACACTGCTTCTTAGTGTGGCCATACGTTTTTACACGAAAGCAA
GATCAGACAAGAGTGCCTGCTTAACGTGACTCGAGTGGTACGATCAAGAACGCATGTATGGGCATTGAAGCGACAAAAAAGCACGTAAACACGCATACCA
TGTAACTTACCTTGAGGCCCGTCAATGCAATACGAAGCCTGCCACAGTCCTGGCGGAGTGTAACCATTCGTAACGAAAACCTCGAGTTAACAAACTGTTA
GAACAGTCCTATCAAATAACGCGCTTGTATTCCCGCTTGCACTGTAATGCACAATGCCACCGCATATCGAAAGAAACAATGATATCAAGTCACTGGTACA
GCTTCTTAAAGACCACGAAACGAGTCACACAGCGCAGAAAAAAAGACTCGTATCCCATCTACCAGAGAAAGAACCCAATACACTGTCCGTGGAAGACTGT
ACAAGATTGCTACGGAAGCTACAGAGCATTCTTCCCAAAATGTTGAAGACGATATCCTCTCTCGAATCCACGTTCGCGCCCGAAACTCTTGGACACCTTT
GTGAGCTGTTGATGATGCTACTGAAGGGAACCGTGTGTCCTCACATCTATTTGGCGTTCATAACTCCGTCCTCAAAGACAGCAAGAGACGATGCGGTGGA
GGGAGATTATGGAAGCTCTATTGGATTGGTGAACTTTGGCACTTTGTATCTATATTTGGTTTCGTTCTATTGCAACCGCATGTTCAAAGAGATACGCTTC
GATCTACTCGCTGTATTGGAACAGTTTGGACTTTTGCTACAGCAATATGATCCATTCGCTTTGGCTCATATATTTGAAGATACGATGGTGAGCATTGAAG
AGTGCTTTCACTATAAGAAGAGAGAGGTCGGGCGGAAGAAATGCGTTTTGTATCCAAACACAGCGATACATATGTTTCGTACGGCGGATGGGTTGTTGAG
ACAGAGGAATCGAAAGGAGGTTTTGTGTGGGTGCCGGATAATTGGGGATACAGCTGAACGGAATGCAAGAGCACTGCAATTGGAGAAACTACTTCCGTCT
ATGGAGCTTATAGCGGGACCACAAGTTGCAGATTTACGTGAACTATGGGAGTCATACGCAATAACATTGATCCAAAATCATTCCACGATAGTATCATGCG
GGCGTGTCAGCAGAAGGCAGGTCTTACAGCTTTGCAAAGTATTGTACCATTACGAACAAACGCAGCTTGATAACCGGCAATTATACGAAACAACGTTGAG
CTTCCTATATGCTGTTTTGACGGAATTCGTATCATCAGACCAAGCACTTGTCGAATTTGGATGCTTTTATTTCGACTCGACTCGTTGGAAGCTTGATTTG
GATTATGGGATCAACACACACTTGGCCATTTTCACTCACTTGGAACGCAGTATTTGTAATTACTCCATGAGCCAACTATTATGGAAATCATTCGACAAGT
GGTTGCTGAAATTAGTGGAAAGTGATATTGTGAAAGCATCTCGGTATCGGGAAACGGCAAAAGTATGGATCCACATGAGCATTCGATTCTTGCAGCAATA
CATTGACTCCAACGGACCATTATCCAACATTGCAAAACACAGACTCATAACGGTGTTTGAGATCATACGACCCGAGCTGTCCAATGATGACAAGATAGTA
CACGATATGTCACGCATTCTCCATCGAACATTTGGAGAGGACGGCACTTTTATAGCCAATTTCATGCGCTTTTTGCATACGAATCTTCGATCTGGTGCGT
TTGAGACGAAAAAACGCAAGCGAGAGACAATGGAAGAGCGTGAGAAGTCTTGTACGTTTGATTCCTTTGACCAAAAGTCGAGCGAAATTCATGTCCGATT
GGCGAATTGGTTCCTGGTCCAGCCAGGTCAAGGCTCTAGCAATGCCTTACATGAAGCCAATTCCTTTTTGAACTCGTTTCAGTTACTCGGGCCAATTTGC
TGGTCACGAGCTGGGGATACCATCACGGAAGCAAAATCAGTCAGAGCATCCATCTTGAAGCAGTTTGACAAAGTGACAAACGAGCTTTCAAAGGATATTA
CAGATGATGGACTCTATCTCATGGCAATGAACCTGACTGTCTTTTTGTTCGTTGCTGATGACATGCAACTTCAGATGCGTGCAGATTCATACAGCAGAAT
ACTATCATTGATGATGACCAGGACGAATCTCAACACTCAAAGCTCGGTGGGCACCACATGGAAGGCCATGTGCGAAATGGCGCCGGTCTTTCGAAGGCTG
GCGAAAGCAGAGGTACCACCAATGCCTCCAACTTGTCTCAGCTACTTACTTTTACCGTATCTCGTTTGGATGCGATACAAAGCACTACAAGGCTTGGTGT
CTCTGAACTGGAAAGAAAGCTTACCTCTGCTTGGCTCATGTGGTCGTTGGACTTTAGATTCCAAGCCAAATGCTCAATTAGAGAGCATTATCTATTGCCC
GCTTCTTGTGCTATTTCTTGTGCGTGAAGATGTGGCTTCCCCCGAAGAAATTGCTGAATACCTTTTGGAACGCATACGCTTATGGATGGATGGAAACGAG
AAATTGACTGCTCAAACACGGACAATGTTATGCAAAACAGTCTGTGCTGTTGTCTGTCTGGCATTCTCATCAGTGGAGAAAACGACACATATTGCGGCAG
ATGGTGTGATGAGTGGCTGCATACTTTGCCATTCGAAGGAGACGTCCCGACTAAAACTCACCAACTACGAGGTCTTTAAAGCTTTGGTAGAAGTCACGCA
TGTCGAGGAAGACACTGAGGCCGCCATGGCTAAAACAGAGCTGCTATGTACAATATTCAGGCATCTGGAAATGTCATTGATGAGTACAGAAGATTTGAGA
AACTTGGTCCACATTTTTCTGCTTGGTTTGTCGTTCAAAGACAGCGCTACTCAAGAGCATGTGCTTGGAATTATTGGACTACTCCCAGATTCTTTGACGT
ACTTGGACCCAGTGTCACGTGATCACAAAGGATTTGGTCCAGAACTTGTAGCGCTATTCCAAGATTTACTGACAAGCCTAGAGAAAGAAATCGATCCATC
AAGACTCATTATGGTGGTGCGAGCGATAGGAGTTCTTTGTCGAAGCTGTGACATCTCCAATCCAATCCAAATGGAGTTATTGCTATTGTTGATGCTGCAA
CTGGTCGTTTTCTGGAATTATTATCAATGGAGGCCTGAAGTGGCCTCGATATTTTACAATCAGATCAAACGAACCGAATCGTATCACAAGCTATCCTGGA
GACGACTATGCATGAAGTATCCGCAAAAGATCTACGTCCCGTTGATTGGAGAATTGCTCAAGTCTAAAGCTATTTGCGATTTCTTGCACACATTTCTGAA
TGACAGCATTGACCCTGCAACATTCTTACTCGCGAGTGCGCCGCACACGCTGTCCAAATATGTCGCCGAACAAGATGAAGAGCAGTTGCAGCGATTCCAG
CTTGCGATGAATGAGTATCAAGGTATAAAGTCCGGCAGTGCAGAATCAGAGGACTCGAATCAAAGCGATCCATTGGCAATTTCTGATCTCATTCTGAATC
ACATTGAGTACATTCTGAAAGAGCTCATCATGCAACAGATCGAGCACATAGAGAATGGCGTGGAGGTTACAACATGGGAATTTCTGTTTCGCTATTTACC
TGCAAACACTACGATTCGCGACGTCATCTTACACTCACCCATGCGCTTGGTCAACTTACTGGTGTGGGAATTCGGAGCAGAGAGGTCTGAGACTGCCAAA
CGGGCGTTCACCGAAGTGCTACGTTATATACATCAAGGGAATAGCATCGAAGCGAATGTGGATGACCCAAGAATCAATACACAGCAGATATTGTATCCGA
TCTCGCGGCATTACTTCTTGGCTATCATGACGGATCTCAGCATCAAAATCAGCAGCAAGGATGGGTTGAATGAAGACAAATCAAGCATTCGGCTACGTGC
GGTAACCTGTGTTGGCCGCTTGCTGGAATGCCTACTTATAGACAAGCGCTGCATGAAGACCGCCGGGCAAGGAACGTCGTCGAGTGAGTTTGTTGATCCA
TTCGTACCAAAAATCATGGCAACACTCAAACTTTTATGGCTTGAAGGGGATATGAATTTGAAACAGCGTGGAATACGTGTATGGACTATATTTGTTCAGC
TGTTATCCGATAAAGCTCTCGGCTCCAATATTCTAGCGATACTGGTCAACACATTACCGTATTTGGCTCTTGAGGCAGATACCTCAGCATCTCGGTTCCA
TCTAGCATCGCACGAGAACAACAATCAGCTTGAGGAATACATACAAAGCACGAAACATAGTGTCCTTGGGCTGCTCAAGTACATATTTGTTTCAAAAAGG
AGCGAACTGCGTGGATCGTTCCCACGGGTGCCAATACTTCCCAAAATCCCGGAATTGGATGATGTCCAAAACATACTGGAAGAAGAAGTGGGTGATTCTG
ATTCGAGACGGATTGAAGATTTCATCAACGATCTGATCAGGATTCTAAAGCACTGGGACAGCAGTGTGCGCGAGCTTGCCCTAAATGAAGTGTATCAATG
CTTGACACGTCGTCAGAATGATATGCAAGGATTGATACAGAGGAATTTCGACCCGTTCATACATGGTACAGTTGCTGAGTTGATGGCTACCATCCTTCGA
CTCACAAAGACGGAAACCAAAA