Description :
From Genome Similarity Track
Location :
contig_2:291903- 295499
Transcript NameFunction/comments
g497.t1hypothetical protein PHMEG_00023011
g498.t1hypothetical protein

Sequence
3596 bases(100 bases per row)
GCGTTGGCTCGCGGACGAGATGGAGATCATGGAGACGCTGTCGCGGCGCGTGCGCCCCATCGACACGACGGCTAGCAAGCAGAAGCTGCGCGTGCTGGGC
GAGTTCTTCCCCTCGGTGGCCGTGGACGTGCGCCGCGATGTGCTGGTGGCTGCAAACTACCGCGAGGACGTGGCGGCGGCCATGCTGGGCGACCTCGCGC
AGGAGTCAGTGGCAGCGCGCGGACAGGAGCCTACGGAGCTGCTGTTCGTGAACCTGCACGCGGATGACGACGCCGCCTCGGAGCTGGCGGACGAGGAGGA
CTGGAGCGAGGTGCGGCTGCCAGCAGCAGCGGCACCGACGCTTGGGTCGTGATCCAGGACGACTGGGAGGTTGTCGACAAGGACGGCGAGAGAGTCCGCA
CTTTTGCCGACGTGCTTCAGACAACGGCCGTGCCGACGATGTCGGCGTGTCCGAAGCGACCGGCCCAGCTGTCGCGACTCTCCATCGTAGAGCACGCTCC
TGTACCCAGCAGCAGACGTTGAAGAAGGTGGAGGGTGACCCTGCGCTACCATTCTACGAGCTCGAGCGCGGCGTTAAGTCGTTCGGCGCACGGAAGCACC
ACCTGCTCCAACACCATCGGTAGACGCCAATGGGTTGAAGCGCGCGCTGGGGCGACAGCGGCAATGGCCCCAGAGTATTTTATTTTTGGAATCGGCACTC
CACGGCGGTGATGGCCAGAGATGGCGACCGAGCGCTCACAAACACTAACAGCAACAGTAACGGGCGGTGCAGATGGCCTCTTCTCGCCACCCCCATCGGA
ACAGCAGTACCATAAACTACCATAAAGAAGTCCCCCGAAATGGAAGCAGCCTATTGGGAAAATGAGCACGTACGATTGTAGTAATGCTGCTCGGCCGGTC
GGGTCGCCGCATTGGCGCCAGGATTCACGGACAACTGCAACCGGACGATGGTCGATTGATCGAGCCTGCAATCGCATTGCATCAACAGTCCCACTGTTTT
CAGTGAAGGTAGAACACTGAGCTCTCGACTAAGTTTGGTTTACACCTGCTCTCTTAAATTCCTCTCAACACTTAACTTAGACCAGTGTGGGCGGACACGT
GAGTCGCGTAATACCGGTACACTGCATTCCCTACATGCACAGACAATGATTAAATATGTTTATGAAGTTTCATGTATATGACAGGTAAAACCAACAGATA
ATGAGACGGCGCCGAATATAGTTTTACAATTTTATAGAATTATGCATACGGTTAAATACAAAGTGAGCACGGTAGTCTGCTCTCTCAAGGCGTTTCACAC
CGCTTCTTCCCCCCCTAGCCGATCATATAAATACCTGGCCGCTGGAGAGCGCTTGGCCATCGCTGGCATCTCTTATCTCCGCCTTGCTCTTCCGCTGCCA
TGTTCAAGGTGTACGCAGAACGCGCGGAGCTGCTGCTGGAGGATTGCCGCGCGGGCGCCGGCCCGTGGCTGCGACTCACGGCGAATGCGTCGACGAGCGG
TGTGGACATCGAGCAGCTGGCCGCGCAGCCCAGCGAGGACGCCGCCACGGTGCCCATCCACGCTGTATACGGCGTGTACACGCTGCTTAGCGGCCCGTAC
CTGGCGGTGGTCACGGATTCGCGCGTTGTGGGCTCAGGCCCGAACAGCGAGAAGATTTACTGCATCCTGGAGCTCACGCTGCTGCCCGTGAGCGCCGCCG
CCCACCAGAGCTTCTTCAAGCACGCAAGCAGTCGCGAGAAGCAGGACGAGCGCGAGTATTGTCGCATGCTCACGACGGCGTTGGCCTCGCGCACCTTCTA
CTTCTCGTACGACCTGGACCTGACGCTGTCGGCCCAGAAGCGCGCGTCTGCCTCGGCCTCGTCGGCGGCGCAACGTCAGTCGCCGTTTTACGCGCGGGCA
GAGGAGGATTTCTTCTGGAACAAGCCCGTGCTGGGCCGCTTCATCGAGCTGGAGCTCAGCGACTGGATCGTGCCCGTCATCTCGGGCTTCGTGAAGGTCA
TCAAGAAGTGCGACGTCAACGGCCAGCGCTGCGATATTTTATTCTTCACGAGAAGGAGCTGGAGACGGGTGGGTACGCGCTTCAACGTCAGGGGCGTCGA
CAAGGACGGATGCGTCGCCAACTTCGCCGAGACGGAGATGCTGCTGGTCAAGCCGTCAAGGGCCGTGTGCTCGTACGTGCAGGTGCGGGGCAGCATCCCG
CTGTACTGGGACCAAATGGTCACGTTGAAGTACATGCCTCGCACGCGCTACGCCTTCTCGGGCCACGAGAGCGTCGTGGACTGGAACGAGCTGGCCTTCC
GAGCGCACATGGACAACCTCATCCAGCGCTACGGTCATATCACGTGCGTGAACCTTATCGACAAGGCAGGCAAGAGTGCCACCGTGCGGGATCAGGCGCA
GCTCGGCTCGGCGTTCGGCAAATATGTCAAAAAGTATAACCTGCTGTCCAAGTCGGGAGATGGCACGAGCTCGGTGGGATCTGCACCGGCGTCTTCGATG
CCTGCTTCCCCTGCATTCCACAGCTTGTCACCCCGTCAGCACAAGAGCATGTCAATCTCCTTGCCCTCGGCGCCTGCATCCAATGGAAGCAACGGGTTCA
GCCTTTCGAACGGTGGAGGTTCTGCTGCAGGTTCGCCGACGAGTGCGTCAACAGCGAGCAGCGAGAAAGGCCCGGGTCTTCAGGTACCCCGACGTTGCAG
TCGTCAGTGTCGCTCCCCGTACGGGAGCAGCCACCACTCCAAGTGGCAGTGCCGTCGGCACCCACGTCGATTTCACAGCTCTTTGCCGAGCCTGTTGCGT
ATGTATGGTTCGACTTTCACCACGAGTATCGTAAAATGGCATGGCACAACCTTTCCAAGCTCTGGCCGAGGTGGAGGAGCAATTCACGCAATACGGCTGG
TTCGAGTGCGACGGCGAAGGACGACTAATCTCACGCCAGCGCGGTGTCTTCCGCGTAAACTGCATGGACAACTTAGATCGCACCAACGTCGTAATGAGTC
TCTTTGCTCGGCGTACGATACTTATGGCGCTTCAGCTCTATCCGTTCAGTAGCGCTGGGAGCGACAAGGGCGATACTGTGCTGGATTCGCCCTATGGGAG
CTTCGAGGTCGTGTTCAAGAACGCATGGGCAGACAACGCAGACTATGTGAGCAGGATGTACGCTGGCACTGGCGCACTGAAACGGACTTTACGCGCACTG
GACGGCGGAACAATTGCAGGTGCTCTGCAAGACGGCGTGAACTCGGTCACACGCTATTACCTCAACAATTTTTCAGACGGCGTTCGCCAGGACACGTTTG
ACCTGCTTGTCGGAAACTTCGCACCAGATAAGCGGGACGAGTCTCCGTTTACTTTTCAACAGCAGCACAGTCTCCTGAACATGATGCTGGAGGCCACCCT
CGCCGCGCTTGCGGTGATCAGTGTGTCTCTCAGTATGCGGCCAGACTTGCCTGTGGCCACACGAGTGCGCGACGGCCTCATCGCTACATTCGCGCTATTT
TCCGTAACGGGATACCTCATCCTCAAAAAGGGGAAGTTCCGTTCCATCGGGCGCCGATACGTTTGCAAGCCAGCGTTCTGCTCCAGCGGGTACATC