Description :
From Genome Similarity Track
Location :
Scaffold_4:291842- 294065
Transcript NameFunction/comments
Phyca_LT1534100167Hypothetical protein
Phyca_LT1534100468conserved unknown protein

Sequence
2223 bases(100 bases per row)
accatcagaatggagacagagaccccattggctgttatgaatcggcccaggaccagaagttcatcatggcaggaacaggagcagaatactttcttcacta
tgtttaaggttaagtggccccctactccgatggatgaaccagtgccacctttcagctcgctgctgctgcaacgctttgatgctattagtaccaaggtccg
gactaagagcgtgatggaggtgcggcagttctatactacagtgatgcagaacatttcgacgctactggaagttgtggagaacgacatcgacctgacgaac
cctgaccaagtacggattgctgtttggtgctggagcaaactgatggctgacaagaatcattatgaagagtaagcacctgcttggttggctaacatgtcaa
cgatcatgtggttttaacacacctgtttgtacttgattaggtttcaagcgctcgattcggaatcttcatcgatgaagctcaacctggccaacgtgttaca
ccagtcaatcattcgtagtcgccgtcaaatgctcaaggccaagtctgacaactcagctaacagcaacacagcacctggcctcacttccatctccgcgtgg
gtatcaaggtcaaacctcagctcattttttgcaagaggaaatgccccaatttcagaggcgtcgtctgtgcaaattcaccacccaatggttcgaaagaaac
actcaaaggcggtgttaactatgccaactgccagcagtgaatccccaaaagtgacgccattgaagcgtaagcggagcgcatctacagagcgttttcctgc
tgctgactcgactaagaaagtctgctctactgaagtggaagcgatttcgttcacaagccccactcccacggacaagcggtctccacgaaatggtgttgcg
ttccacacgccgcagcagtcgcgaaagaaggtctacatcaagatgcgtatggtgcctcggaataagcagacgaaggcggatgtagtgcgttgcggctgtc
ggccgaaggtggagctcaaactatcgtcgacgaagaagatctcagagatcacggcgcacatgagcaagaagtgggcgaaagtgcgttcagttctgcccca
agaggccgtgttgtgctttttcgagaagaatgggactagcaagtggttcagcgaggactccaacgtgtcttgttttgatatctggaagcaatgtggcaag
caaagcaaaggagaaaacgtggttgaggtgtcatatctgtggagggttccagagaaaccggttgatgaaaatgttcacgcacaagatttggtgcctttgc
tggccccacccggacttttcgagcaggaagtggctaaaagcgagaccgcgcagttgtcccctgcccatagtctgctggagttcggccagaaagttgcatt
tgatcgaagcattgccgatgaagcgaaagaggaggcagcagctctcgaagctttgatcagtgacagcggtggcgaagaccttggggatgagtttagcccc
actactggccgtttgcgccggcgtatccagccgatgctggtttcaacagaagagttcaatatctaagaggaagcagattttgtaatagtactcacttgta
tcgggaaaagcaaaagtgccgccgcatttgtattgtccgaacttgtctaatttgtcggctgagctagcaggagacggtagtggaatccgctctctaaaga
ccgaacctgcatgcctgcgagctctttcacagggtgaattccagactcgaagttccattcgaacgcccgaccgtcagctgtgcaggaaatgtcagtaagt
aataatctttacagtatcaacagctcaagtgacgtacttgtgacaaatgaggatttgtccacgcccttgccgatcttcacaatgtccttagcacgcacaa
cttgctcgttcgtgatctgaactggggttgtatgcatttgagaggcgacatgagcaaagtcgttcttttcctgacgacctgaaggcgtacgaccagccaa
ccagatcttctcgtcggctttatcacaagaaaacaacacatattgacgttaaacacaaactggtaatcagcaattgggcaggtactaaccagtaatgaaa
gtcgtgtgaaactggctgcacttcaatagcttcacggcatcactagttcgcacgagtcttggggtaatttggtcaccgttgctctcttcttgccccttcg
ggttcaacaattttccccacatg