Description :
From Genome Similarity Track
Location :
Scaffold_203:29181- 31748
Transcript NameFunction/comments
Hyaar_Emoy2812523hypothetical protein
Hyaar_Emoy2812524transmembrane protein, putative
Hyaar_Emoy2812525PREDICTED: uncharacterized protein LOC612638

Sequence
2567 bases(100 bases per row)
GCGTATCACGAGGTCGCGTGTCTCCGCCTAGCTCCAATGGCGGGACTCATGCAGTGTACGTGCAACCACCGGCACCCGTCTCCAGTCGAGTGCGTGCCCC
TGTCGCGAGCTACGCGGCGTTTGCTGCCAGAATAGAGAACTCGCAGTCGCGGCTATTGGAATTCGAAAAGGACGAGCGATGGCTCGTGCAAGTCGAGACT
ATGAAGGGTCGAGTCGAGGCACTCAAGAGGAAATCGCAGCTGGCTTTTGCAAGGGAGGTGGTGGCCAGTAGTTCTTCACGGAAGACTAGGAGCTTGAGCG
AGTGCAGTAGCGTCTCAACGGGATCTACCGCGTCAATGTCGTCAATGGATACGCTCGAAGGCAGTAGTTGTCAGTAAAGGCGTAGCGATCAAACGATTAA
ACGGGCGATTGTACGATCGACCTTATCTAAGTTATTAGTATCGAATCCTGAAGTTATGTGCGTCAGTCACTTACTGTATCGTCACACGTGTTCGCGAGAT
CGTCGAGCCCCTAAACGCTATCGTCAATCGTGTCCAGTCTATTCGCCTCCAGAAACAAAAGTATCACCAGTTTCAGCCAATCGCACAGCTCCACTCGCCA
CCCCAAATTCGAATGTTGTGTCTTGTACATAATTCGCAGTAACGACTCGAAGTTACACCGTAACCCAGTGCGAGAGACTGACTAGAAGAGAGAGAGAGTG
ACCAAGAGAAGGCGTGTGCAGGATGAAGACGGAAGCTGTGCTAGGAGGCAGCGTGCTGAACGCTGGGCCATTGGGTGCCGAGTACGTTCTTGTGTATTGA
TTACGCTATGCTTTGTGTCCTTCAGAGAGGAATAAATGGCATATCCCTTGGTTTAATGACTGACTAGGACAACGTATGGGAAGCTGCCACCATTAAACCC
CGAAGACCTGAAGCTACCACCTCCGCCGCCGTCTGCTGCTGGTAATGTGACCGACACTGCGAACGCCATTTCTGTCCGGGAAGTCTGGGACGAGCTGAGA
GCCAAGACGCGCGAAATGTACGTCTTTTGGAGAGCTATTTTGTATTATCGGGTGGCTAAACGGACTAATGCAGCATAACATATTTGTATATTGTGTTTGT
CAGCATTATGGGCTCGTCCGCATCGGGCGTCATGTCGGCCATGCGCATGATAAACTTGACGATGGCTGGCTGCATGACTGTTCTCGCTGTGGGTCAACTG
ACGTACTCGAACTCGGCGTTCTCTGTCATGGCAGACGCTTTCTCCGTCATTTATACCATGTACGATATCAGCTGAAAATGCTGTGAAGATATCAACGGTG
AAGGAAGGGCTATGGGCTGACTTTGTTGCTGGCTGTAGCTTTTTTGCACTGCTGCTGGTTGGCTACGAGCTCCGTACTGCGTACATTGACAGGCTGCTGC
GTGGCAGCTTTGGTTTCATGTACAGTCCCTGGGGTCGATGTCTCTTTTTGAGCATGTACGTTGTCAAGTCGTTGTTGGTCGTACTACAATAGCGGAAAGT
GACGATGCATGTGGTACACAGGATCTCTATTTTTCCGTTTGGAATGTGCGGCATCTATGGCGTGCTCGTCTCGCTAGCAGGCTTTGCCAACGCGTACTTC
AATTACTTTGTTATTGTGAAGCACCCGTCGTTCACGCGCGGCGTCCCGGACTACACGCCTCCTATGCATACCCCTCCAGCCAATTCTGCGACGATCAAGG
AAGAGGACACGACGGTCTAGGCTGAAGTGGTCGCAAGCAGGCACGCATCCAGCGTTTTCAGTCAGTCGCCAATAGCGGTAGTATTAACGCATATAAATGA
CTTTTCATAACTTTGCGGGCTTTGAGGCCTTGACTTTTGCGCTTTTTATGGTCGATCAAGACTGATCTCGCGAGCTGGATATCAGTCTCTTAATAAGAAT
ACAGATGACATTTGAGAAAGCGCTATGCGAGCGCGTGTGCAAGAAACAAGCCTGCGCCATCCAATTCTGTTTGCAGCGCCACGGGTACCAGGAGAGCAAA
TGTGCAGCGGTCATCAAGCAGTACTACGACTGCTGCGCTGCTGCGACCAAAGCAGAGAAGAAACTTCTGCAAGATCCTGGACGAGTGGTCGCTGCGGACG
ATTAAGCGAGTCGAAGTCACACCGCTCGGTGTTTTGTTTTCGATAACCGATATGCAGGAATTGATGCAAACTTAGTTGTGGGGGGCGTGAATTAACTGGA
TAGTGCCATGAGATAGTATCACTTAGCGAGCTGCTGAATGTTCACATACTACCAGCAATAAAGAATGTGTCCAAGCCAGTACCACTTTGCGATATTCAAT
GCAACCGTGACATCACACAGAGTCCTTCCAAATATAAGGAGTAACGTGATACAAATTATGCGACTGGGAGCAGTGTCGTCAGCTGGAATGGGATAGGTAC
GATTTTTGGAAGGTGAAGGAGACAGTGGACGCGTACCGGAAGCTTATAGCAAGACTACGTAAAGGTGGTCGGACTCATCGCGTGAATTATTACCCGCGGA
ATACGCATGGCTGGGGGATCATGCACGAGCTGCCGTGCTTCTTTCAAAATTGTCGTTGCGGTCGAAC