Description :
From Genome Similarity Track
Location :
Scaffold_53:291778- 292846
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16111ATP-binding Cassette (ABC) superfamily

Sequence
1068 bases(100 bases per row)
TCTTTGCCTCAAACCCCATTGGATATGAAAATCTTCGCTCTCATTGCCACATTGTGCAGCTTCGCGGTCGCTGCTGTCGAAGAAGAGACCAAGACTCTCG
ATGAGTTGTACGCCGATGCCATCGCTGAGGGGGGCAACCTCATCATGTACCATGGAGGTGACACTCCCACACAACAAAACCGCATCAAGAACGCATTTGC
GGCAGCGTACCCGGAGATTAACTTCACCCTGATCGTCGACTACAGCAAATATCACGACGTCCGCATTGACAATCAACTGGAGACAGACACGTTGGTGCCC
GATGTAGTAGCTCTGCAGACGCTTCAGGACTTTACTCGCTGGACCAAGACTGGCGATCTTCTTCCTTATAAACCTAAGGGGTTCTCGGAGATCTACGAAA
CTCTCAAGGATGAAAGTGGGTCGTGGATGGCATACACGATCTTCACTTTTGGGTTCGTATATGACTCAAGTGCACTCAACGGGACGGCAGCACCTTCGAC
GCCTGCTGATCTGACAGACCCGAAGTGGGCTGGTAAGATTGCGTCATCTTACCCCCACGACGACGACGCGGTGCTCTTCCTGTACACGCGCTATGTGGAG
AAGTATGGATGGGACTGGGTGGCCAAGATGGCCCAGCAGAACATCGACTTCAACCGTGGTTCGAATGTCGCTAGCGACTTGGTCGCTGCAGGGGAAAAGG
TCATTGGTGTTGGTTCAAGCGGCCGCGCCGATCCCATTACCTTCGTTGGTGGCAATGGTACGGATTACCTTAGCTGGGGCCAGCGAGTTGGCATTCTTTC
GAAAGCCAAGCATCCTGCCGCGGCAAAGTTGTTCATGAATTGGGCCGTGTCGAAGGAGGTGCAGGAAACGGTGATTTCGACGACGGTGCGTGCCGACATT
AACACCACCCACCCTTGGAGCATCCCGGAAGCGAATATGGCAGCTTTCCCCGATTTCATGGAGGACCGATCCAAGGTTGAGCAGTGGAAGCAAACATTTG
CACTGTACTTCGGCGAAGTGCAGGGGGAACCCAGTCCTGGGGTCCTTGGACTTCACCCCGGCCTCTAA