Description :
From Genome Similarity Track
Location :
Scaffold_308:29177- 33842
Transcript NameFunction/comments
g12853.t1XP_009522372.1 hypothetical protein PHYSODRAFT_312723 [Phytophthora sojae
g12854.t1RAW29489.1 hypothetical protein PC110_g14144 [Phytophthora cactorum
g12855.t1XP_009535352.1 hypothetical protein PHYSODRAFT_564652, partial [Phytophthora sojae
g12856.t1OWZ10474.1 Ubiquitin-specific protease [Phytophthora megakarya

Sequence
4665 bases(100 bases per row)
AATGCTTAACCGGCAAGTTAGTGAGGCGGGCAACGGGATTGCTGAATCCATCACTATGCTGACACAACACTGTTCACGCACCAAGCACTTTAAAGAATAC
TCGCGCTCTTGCGATCTCGGCGGCCATAATCTCGTCAGTGCCGACCAAAATTCTCGCTCAGGCAGGGCTGCCTCTGCCTCTCGACATCTGTTGCCTCATA
CAGCAGCTCGATCTCCTCAGCACCACAGCGCACCGTGATATTGCTCCTCTCGCTTGGGGCTACTCGCACACTGCACCGCAAATACGTAGCCGTCATGAGC
CTGCTGCATAGCATATACACACACGTTCATCCTTGGCCACTGAGCTGCGCTTGTGCTCCAACGCCACAAAGCTGTAGTTACGCATGAAGTGCTGTTAGAT
AGATGTGCCACACACACAAGCCTACAGTACCTGCGCAGTCTATCTGCCATCACGTCGCAGCACTGCTAATCGCCTTCGTCTTCTTGCCTCCGTGGTTCTG
CTAACCGTCTTCGCCTTCTTGCCGTCGCAGCTGGCTTGTCTTCTAGCTTTGGCAGCTGGCCCCAGCTTCACCATACGCCACACGCACGCACACCAAGAGA
TACCAACGGGAGGAATCGAACCTCCACCCCCCGCGAGCGGGACTCTGCCGATAAGCTACGCTGGTTTGGCGTGTGCGTGCCGTGCAGCACTTGGGCTGCG
AGGTGATGCTAGCTTGATCCGACGAGCTTCGTCTTGGGCCGGCGAGTTTGCGAGTGAAGACCACCCGTTGTCCAGTCGATAATATTAGCAAACCAGAGTG
CCGACAATTAGGGCCGGTTTTAGCAGAGAGACTGACAAATTAGGCAGATCCTTTGAGATGGGCAACTGCTTGCGTAACTACCTCCCAAGCAGAGGCAAAA
CGACAGAAAAGCACAATACATGTAAAGTTTACGTACCTCGACTACATGTGTATGTTTACAGTAAAGATACGCATGTAGTCGTGGGCGCGCGAAGGTCGGT
CCTGAGAGAGATCTCTTGCTTTCCGAGACCCAGACACCGACTGAGGGCCACATTGGAGGTGGTGATTGTGGATGTTGCGTACATGTAGTGACGTAAGTGA
GGGGCTCGCTGGCAGATGCTTCCCAGCAGCGACACTTTCCCGTTGGCAATAGGATATTAAGCTTGGGCCAAGCCACTTGGGATGAAGGTGCAATGGTTAG
CTACAGTTCAAACCGTGAGTGACGGTGTCGAGCCTTGAAAGCGGAGGCTGCTTCTCACTTTTCCTTTGGCTTCCTCGTTTGCACATCCATTAACAATCTC
GGTCTGCTGCAATGGTTTCCTTCGTCGACGCTAACAAGGTTCTGACCTCTACACCCCCCTCGCACTTCTGGGACGACTGGGAGCACAACTACGCACCCGT
GGGCAATGACATCACTCTGCACTACATCGACGTCGGACCACGAGACGCCACCCCCGTCGTGCTCGTCCACGGCTGGCCTGACCTCTGGTTCGGATGGAGG
TACCAGATCCAGGCGCTGTCCAAGACGCACCGAGTGGTCGTACCAGACTTGCGCGGATTCGGTCGCAGCTCGGCTCCCAAGACGGTGGAGGGGTACGGCA
CGAAAAAGGTGACGGGAGACCTCGCGGGGTTGCTGGACTTCCTGAACATCCCTCGCGCCGTGTTCTGCGGACACGACTTTGGTGGTGTCATGACCTGGAG
AATGACTTTGTTCTACCCGGAGCGGGTCATCGCAGTGTGCAGTGTTTGCACCCCATACATGCCTCCTTCGGACGTGCTCGTGGATACAAACGCTCTTGTA
CGCGCTGTCCCTCAGTTCTCGTACATGACCCTCTTGAGTCAGCCTGAGGAAGCCGCCAAGTTGCTCGATCCTGAGCCGCGTCGTCTGTTCACTGCCACGT
TCAGACTGTTCGCTGACATCGACACCTCGCTGACATTCCTGGAGCTCCTCCATGGCGTGACAGACTCACCCAACCCGATTTTCACGAACCCTTCCAAGCT
CCTCGAGGAAGCTGAGCTGGACTACTACGAGGAGGAGTACAAGCGATCGGGCTTCGCTGGCGGGTGCAACTACTACGCTGCAAGGTTCATCGACTACAAC
GACGAGCTCGAACTTCCTCGCACCATCACGCACAAGGCGCTTCTGATAAGCCCTGCGGAGGACCGCGTTTTGAAGCCTGGAATGGCAGCTGGAATGCGCA
AGTTGGTCCCAAATCTGCAGCACGAGATCGTGAAAAACGCCGGCCACTGGACTCTGTGGGAGCAGTCGGACGAGATCACGCGGATTCTGCAGCAGTGGCT
CGAGGAAGTTGACCTCGATGGCTCGACATCTGATAAGGTACCGTAGCGAAAAGTTAAACGTCAGCTTTGTTGAACATTTTCATAGGACTTTTACGAGCAC
ACAGCCACCCTGCGATCCCAATAACACGACTTTTCGTCTCTTCCCTGACATCGTTCACACGAAAGCTCTCAGTTTGGTCGCGACCTTCAATGTCTGGCTA
AGCTTACAACTTGCAGCGGTCGGAACGAGGCGGCGCTGGGATTTTGGCCAGCCAAGTCTTCAGCAGAGCGTTCACGCGCGCCGTCTGTTCCCACAAGACC
CAGTGGCCGGCATCGTCCACTACGTGCGTTTCGAGATTGGGCAGAAAGCGAGCCATCTTGCGAGCCAACTCGGGCTTGAGCACGTGGTCATTCGCTGCCG
CGATGAACATCGCGGGGTGATTGATGACGGAAGGCAAGCCCTGTTCGTCCTTGAAGTCGATGTCGCGGGTAGCGTAGTACTGGCACGTGCTCTGGAACTT
GGAGCGTGAGTACTGATCCACATAGTACTGCATCTCCTCCTCGGACAGCATTGCCGAGCGCTGCGTGAAGATCGGATCCGGGGAGTGTGTCACGCCCTGA
AGCGTGCCAACAATGGGCTTGCTCTCATCCTCCAGCGTTGGGCTCATTTCCGTGTGTTTGCGGAAGACAGCGGTGAGGAAGCGACGAGGAGCCGCATCCA
GCATCTTCCCTGTGTTTTCAGCGTCCGCCAGCAGCTTTTGGTACGCGAAGTATGGGACGTGGGCAACCACGACATCCAGTGGCACCAGGCGCTTCGCTGG
CGGTGTGAACGCTGTGCATACAGCGCAGACTGCAATCACGCGCTTCGGGTGGTAGAGGCACATGCGCCAGACCTGCACGGCACAGACACTGACGTCGTAA
GCAAAGTCGAACCCACAGCGTTTCCAATTGAGGCAACACTCTCCTGGTAGCCTCCCCAATCATGTCCCGCGAACACAGCCTTCTCAATGTTCAGGCCGTC
TACCCCAACAGACCGTCAGCTCAAAAGGTAACGGTTAGGATAGCACGAAGCTAATGCCAATATGCTCACCCAATAGCGCAGCCAAGTCGTTCGTCACATT
CTTGGCGCCGTACGCCTCGACATTCTGCGGCGTCGAGCTCTGTCCGAAGCCGCGAAGGTCTGCACCCCCACGTTAGTTTACCGATGTTAACCCTACAGCC
ACCAAGACACCATTTACCGGGGACAATCAGTCGGTACGTGGACTGCAGCGCCTGAATCTGGTGCTGTAAATCCACGAAAAGGTCAACCACAAGTCGCTCG
AGACCACAGATCACAGTAGCGTCGTACCCGCCACCCGAACCAGAGGTCAGGCCAGCCATGCACCAGCACCACAGGCAGCGCGTCTCGAGGCCCCACATCC
ACGTAATGCAGCGTGATCCCCTCCGCCGTGCGCATGAAGGCGTGCGGCCATTGAGACGCCATCGTACAAGAGTCAAGTGAGTGCTTGAAGTTGTATGCAT
CAACCTATGCTATACAATAGGTCCGATGCATCATGTACCGTATTATAGGCCCTATATATCAACATATTACCTACCATAGGTTTCTTAATTACACGTAACC
GCTTCTCGGCGACCTATTCCTGACGGCCCGTCATGGTGTCGTGTGGAGATAAGACCGGAAGACGGCGCATATTCGTACACTAGGCCCCTATATTCGGTGC
ACCACCTCGCCAGAAACTGGTGGCGTGTCTCGCTCCAGACGCGCGTCCTTCTCCCGCCTTTTTGATACTTGTATGGCCGGCTCGCGTCTCTCGTCGACTC
CTACACGCGCCGTCGACCGCCCGCAGCAGGCAGAAGCCGCCATGTTTAAGCAGGATCGCCCCGCTGGAGGTGCGTCGCTCTATTGCTCTGACTCGTAGGA
CAACCGCCTGATCGTCCCGTTGTGCTGCAGTGCACATCCGCAACCCGCTGCGGTCCAAGAGGGTCGCGGGCTCCGTGACCGACAGTTTTGATCACCCCCC
AGCAGCTGCAAAGCCCCCGCCCATCGGCGGCAAGTTCCTCGGACGACCGGCCAGTCGAGCGGTGGCGTTGGAAAACTCGAGCTCCCGCGCGTCGGCGGCG
TTGGCATCGCTCACGCGGTTTCATCCACGTCAGACGACAGCAAGCGGCAGCTCAGTGCGAGAGAGGAGCACCGACGAACTGGACGTCAGCAACAACGCAA
ACCTGCCGACCATCGGCACTAGCGAGCTGCCGAGACTGGCGCCCAATGTCGGGCCGTCCACCGGCAACATGACTACGAGCAACATTGTCACGTCGCAACC
GACGACGACCCCGGCGATATCGTACCCGGCGAGGGTCAGCAGCAGCGGGAGGACGTCGTCGCACA