Description :
From Genome Similarity Track
Location :
contig_47:291759- 298717
Transcript NameFunction/comments
g9691.t1hypothetical protein
g9692.t1POM70904.1 Zinc (Zn2)-Iron (Fe2) Permease (ZIP) Family [Phytophthora palmivora var. palmivora
g9693.t1hypothetical protein

Sequence
6958 bases(100 bases per row)
CTCCAGACTCGGGTTCTCCATCTCGTGCGTCTGCTCGTCCGACATCTTTTTCGCGTTTGGGTGGCGCGCTGAGGTTTTGTCTAGTTCGATCTAGCGTACA
CTATATGTACACAAAATTACCTATACAAAACGCGAGTGGGGGTTTGAAGGATTATCATGTTGATGAAGTCAACCGCACTACGACCATCTTGAGGATATCG
AGTACCGCAGCAGCGTTTCCCGCCAGTGCAGACACTTCGACATATATCACGTTGTGCTCACTGCACCACGTGCGAGCTGCTGCTTGCTCCCTTTGGTCCA
ATTGATTAACGCAGTCGCTCTTGTTGCCGACCATCAACACGGGCAGTGCCTGCGTAGATTGCGTCTCGATGGCTTCGCCCGCCGCAATCTCTCGATGAGC
GACGTCGAGGTACTTCGGCAACGCGCGCCACGAAGCTGGCGTCTGCAAACTAAAAACCAGCACGATCGCTCGAACGCTGCGAAAATAGTGCGCGAAGATG
TTCGGCCCCGCGAAGCTCTGCGGCGGCACGTCCCACAGCTGACGAACTCTCCGTTAACTCAAGGCCAGATCATCCCAAGCATCAAACAAGGTGACGCACT
TCGAAAACTACCGGTTCGTGTCCCTCGAATCGAAGCAGCTTGGCACCTACGTTGGCTACACGGTGCAATGCCGTAATGTGAATGAGTTCACGCAACAGCC
ATATGACTCGCAGCCTCGCTTGCTCACCCGTGGTGGACGGCGTGTATTCCCCATCGAGCTGGGTCCCTATCAAACGCCTGAACAGCGTCGTCTTGCCCAC
TGCCGCCTCGCCCAGCACGACCACCTTCAGCTTGTCCAAGGTCAGTGGATCCGAGCCTTTATCTTGCACCGCGGACGTGTGCCTTCGCCTGCTGCTGGAC
GCTAAGACCAGCACATCATTAGTCGCTGGCAGCTTGAAGTCGCCCGCTCGCCTTCGGACAGCGCTATACATGCATTACGCCGCCCACGGTAGCCAAGGGC
CCTTGCCTTACCTCGGGCGCCCATGCGCTGCGTCGTTTGCCAACCGAACTGCGGTCGCCGTCGGACAAGTCCCATACCGCTACTGTATAAAGGTCAAACT
CCTGGTATAATCTATACCTCTATACAAGTAAAACGTATATCCTTGCATAACCGATTGCGATGAAAGTAAATTCAATATCGAAATTCGACCTTGAGAAGTA
GTTTCTTCTTCACTACGATGCTACTGACGTATGGTCCACCATGCCGTAATCGAGATGTATCACAGTACGTCCGCTTGGTCCGCCGTCGGATAAGGCAAAT
GGCTGCGGATGTGCTTCGGTCCAGAGACCCTGGCACGCTGCACTCACTCTACGATTCTCTTGTGCGCGCGCAGGCGACCGACGCAATCTCTCTTCAACGC
TAGCAATGGACTCCGTGGACGAGTTCAAGCTGTTCGCAGCGCTCTTCATCTGGGCGCTGGGACTGCTGGGCGGCATCGCGCCGCTGCTGAGCAGCCAGCG
CGTCAGCAAGCGCGCCAGCAGCGTGCTCAACATGGTGGCGGCCGGCATCTTCCTCGCCAGCTCGTGCATGCACTTGCTGCCGGACGCGCAGAACAACGAG
GCGCTCAACGAGTGGGGCTGCGAGCACACAGCCGAGGTCTTCCTCGCCGTCCGGACGCACTACGACGGCGGCAACAAGCGTTGCTTCAAGTGGGCCAACT
TCTTTTACGGCTGCGGCTTCCTCATGGTGCTGCTCATCGAGGTGCTGGCGCACACGCTGCAGCGCCACTACGGCAAAGTGCACGGCCACGGCCATGCGCA
CGGCACCGATCAAGAGCGTGACGCGCTGCTAGCCATCGAGGTCACCCGTGCTGCCGAGCTGGACAACCTGGCCACTGCCAACGAACACTCGCACGGACCC
GCTCACGGACACTCGCACGGGCAACTGGAGACGGGAGACTATGGCACTCAAGCAGACGAACTCGCTGTCCAAGGCGAAGACGGAAAGGAGGCGCCGCACT
CGCACATTCACGGCATCGTGAAAGGCAACCCTATTTTGGCACTCGTGGTGTTCATCGCGCTGTCTTTCCACTCAGTCATGGAAGGCATGGGCATGGGCGC
CTCAAGCACGGCTGCGTGGGATATCCTCGTCGCAATCTTAGCTCACAAGTCGCTGGCCGCGTTCGCGCTGGCACTCGAGTTCGTGCACCACAACGTCTCA
CAGAAGCAGCTTCTCTCGTCCGTGGCCATCTTCTCGCTCATGACGCCTACGGGCATCCTGTTCGGTCGGTTGCTGGTGGATACAAACCACGCCACACCTG
CTGCTGGTGTATGTGCCGCGTTCGCTGGTGGCACCTTCCTCTTCGTCGCCATCATGGAGATCATCCCGCAGGAACTGCAGGACCCACGATACCAGATCGA
GAAGTGCTCTGCTCTGCTCGCCGGCTACGGCGCCATGGGCGTGCTCTCCCTCTGGACGTAAAAACACTTTTGACTCATGTACAAGTATTCTCGAAGATAA
ACAAGAGCGTCGAACGTCAGTAAGGGCATTCAAGAGCCCGCTTCGCCTAGTGCGAACGTCAATTCAGAATTCACTGATAAACGTTAGTAAAAAAGTTAAT
GAGAGAAAAAAACTTACTCAAGTAGCTAAACCACGCCCAAAAACGTCGAGGGCTTCTCTTCTCTCTCAATCTGGTAGCATGTGGGTTGAACGAACCGCTG
CTACTCCACACCACCATCGGCTGCTACAGGCTCCAATGCAGCCAGCGGATACAGCCATCCAGCAATCCTTGAGTTCGCATCCGGCGTTGCCTCTGCTTAT
CTGCCGTACTTCTGGAACTCCCACTCGCGGTTGTCCAGCGGGCACACCTGGCGGGTCTTGAGCCACCTCGAAATACAGTGGAAGTGGAAGGCGTGATCTG
CAACAATAAAAATCACAATACGCCATTAGCAAATAATCCTCTCAATCCCAACCCCAGGCCTCCGACGTACTGCAGACACCCCAGGCCACCGTGCACTCCT
CGCTGGTGGCCGACGCCTGGTTGGCCTGGCACTCGATGCACAGGTCCATGATGTGGTTACGGCAGATGGCGCAGTTGTCCACCACGATGTCTAGAAAATT
AAAACAACAATTAATTATCAAAGCCCAGTAAAGATCTCGGCGTGTTTGCGGCGGACGCACCCCAGGACCACAGCGCCACGGCGTTCCACTTCTTGATCTC
GAAGCGCTTCTCCTCGCTTGCGTTTGCCGCCGGCGCCACGTCCGCCGTCACCTCGCTCTTCATCTCCTCATCCATCGTGCTGCACTTGCTCGAGCTCTCG
ACGCCGGGTTGACCGATAGATAGTGAATGGTTTCTTCCTCTCGAAGGGAAGGTACCTTGTGTATTCACTTAAGTACGTATATGCGTCGTCGGATACCGCA
ACTTTTTCAAGCATCTTCGCCTTTGTTATACCTCGACGGCAACAGCGATGGCATGCAATTATATACTTGTACTAGTACTACCTACACCACTCAATGACAT
TAATCAATCTGTCTACCTATTGGCATCGAAAATATCTCAAGCTGTCACCCTTACTCAGCGCTCGCGTCACCTAGGAGCTCCAACACCGCTGAGCTTCCCC
GTTGTGTCATCCTGTTCCATCACGCATAATTATTAGCTAGCACACCAAGTCTCAAGCTCACAGTCTCACCGATGAAACAGCGGTGCTCATCGACCACTAT
TCTGGTGCTCCATGGCTGCTCTTGTTGTCCAGTTGCACTGTTAGAATAACAATTAGAGAATGCTGGGCCAGCGAGGCTGGTTGCACCTTCGAGTGGAGTA
AGCACTTCAACATTCGCATGTTTGAATCCTGTCGCGGCGAAAGTCTCAACATGGGATGGCTTGGTGTTAGAGAAGCACGTTCATGTTTAGTGCCATACTC
TCAAATCGTTCCTATCACGCAACTAGCTCGTCGCTGCTCTGCTGCAGGTAGCACTTCAACTACCCACTGAGTAGTTGAGCAGCGACGGATCGATCTTCTG
GCCCTTGGTGCGGCGCTTGCCCCGCTTGTTGGAGGAACCAGTCTCAGACGCGCGCTGCTGGGCGTCCTGGTGCCCTGGCGACTTCTTGCCGCTGTGCTGC
GTTTTCTTGCGCTGGATAAACTCAGTCGCAAACGCCGACACGCGCGGTGTTGAGCCCAAATATGCCGCGAGATACTCGCGGATCTCGCCGGGATCCTCGA
CTGACGCACAGTATTCCAACAGCGTCACGTTCGCGTTACTATCAATGGTCGTCAGCTGCTTCATGGCCCACATCATAAACTCGGACGACACATTGTTTGA
ACCAAACGCATTTGACGTGCCCACTTGCACGCTACCAGACGCTCCTGCCGACTCCTTATCAGCCGGCTGAGCAACCCCGAAGTTCCAGAACGATGCATCG
CTTTCAGCCTTCGGCGGCGATGGTCTAGCAGCACCGTTCACAGCACGAACCTGCTGGCGGCTCTTCAGCACAGACGCAGGCACAGGGCCTAATACTGACC
GCGACGGCTTGGGGATTGCTGCTGCAGCAACCTTGTTACCCGCCACAATGTTCATCCAGTGCGAGCTGGTCGGCACATTCTCGTTAGCCTTAGCCCGTTC
CTGCGCCAGACGTTCTTCTTCTGCCAGAATGTCACGCATCGACTTTGAGTTGGAGCGTTTAGGCACAACGGCAGGGGCACCCCACGGACTTGCTGCAGGT
GCAGCAGGCGCCGGAGTTGGGGCTGACGGTGATTTAGCTGCTGGGGCCGGGGCCGAAGGACTGCTTGGTGCCACAGCCATCGAGTCCACGCCCAGCATCA
TCTTCAATTGTGCTCCCATCTGCGCAAGATTCGAGGAGCCGGACTGCTCGTCGTCCATCTTGCTGAGCATTTCGCGCTGCTCTTCCTGCTGGATATCCTT
CAGCGACTTCGATGCATTAGAGGCAGTAGTGGATGCCATCTTGGTGGCCCACGCATTTGTCTCACTCTTAGCGTTTTCTCCTTTCTTTCCGTTCTTTTTA
GGCGGGCTAGTGGTTGCCATCTTCTCGCCTTCCCTGTCAGTCTCGTCATCCTTTGCACTTGTCTTCACAGGTGATGCAGCCTTGCGCTGTTCTTGCTGTG
TGCCAGCTTGCTCACCATTTCCGCCAAGCGACTCGCGAACTTCATTAACAGCACGGCGCTTTTCATCATTCTGAATGTCATGAAGCGTTGGCGTTGGGTG
CTCAGGAGAAGTCGGGCGACCACCCCAAGCATCGACCACAGGGACCGCAGCTGGACTTTTTGGCGCGGGAGGTTGAGTGGGTTCTAGTGCCATCGGACTG
GCTGGTCGCGCACCCAGCGCGCTGGTGGCGTTGTCCAAGCTAGACAATTCCGGTGCGGCATTTGGCCAAAACGCCTGGTCGCGCCTCTGCACTTCGTTAT
TCAAGAACATCGCATCTTGACCGAGAGGCTGCGGGTTCTGCATGTTAAGCTGATGCTGTGTACGATAGTCGGATTGAAACTGAATCTGCATACCGTCTGA
CCGGAAGCTGTCGTTTGCCGAGTTATTGTTGCTCTGGTTTCCTCCAAATATGCCAAGCGCACTCATAATGCCTTCACGCTGGCTGCGTTGCCACGAACTT
TGCTGCTGCAGAAGCATTTGCTGTTGTTGTTGCTGCTGCTGCTGCTGCTGCAGTTGCTGCTCTTGTTGATGTTGAAGCATCTGTTGCTGCTGATACAACT
GGTTTTGCTGTTGTTGACGTGCTATCTCAAGGCGCTGCATTTCCATGCGGATCTTCTCTTCTTGGAGCATTCGCTGCTGTTGCTGCTGCTGTAACTGCAT
CATCTGCTCCTGTTGCTGTTGTTGTTGTTGACGCTGCAGCTCCAACAGACGTTGCTGCTCATTCTGGCGAAGGTCAACGTGCATACCTCCAACTCCGCCC
ACACGCGTTGGCGGGGAAGCGAAAGGCACCTCTCCGTGGACAAACTGATTCGCGAGGGCCCCAAAAGTGCCTTCTCGCCCGAAACGGATTGGAAGGTGCG
GCTTGAAGTAACCCGCCTCGAACCACTCGCGCATGTCCGCTGTTTTGAACGGTCCCTGCTGCAATCCCTGAGGATCCAAGTAAAACCACTCGTCTTCCAC
TTCCAGACGCAACGACGAAAGGCCCGGGAATCCCTCCTGGGGCTGCAGTGGTGAAAGCGAAAAACTACTCTTCTCCTCTAACGCGAGCTGCTCGCGAGCA
GGTTCCAGCGCATCGAACAAGTGTCCACCACTTGACTGGCGACCCAACAAATCTGCCGTGTGATCTTCCACTGGACCATTGGCACCGTTCGCGCTGTGTT
GCTCCTCGGGAGCAGAGTCCTCCCACTGCACGTCTTCATTATCACTGTCATCAAATTGCCCAGCAGCCGCAGCGTCCTCCAGTTTCTGGTCAAAAGCATC
CAAATCATCTTTGATCTCGTCCTGCCAAGCAGTACACCGTCAGTTCTTCGCTCATACGCACCTAATTCGTCGGGGCTTGGGCTTACCGGGTCGACCTTCG
GTCCCTGGAGCTCCTCTCGCATCGCATTCATCTCTCGTCGGAACTTCTCTGCGGCTTCAGCCATACTAGACAGGTCCTGTACCACAAAACACAACAAACA
GCAGAGTAAGCCATCCCCAGCTCCTTCAATATCACAATACAGGGACGCACCATTTCATTGTTATCCGTTCCAGGCTCCAGCACGTCGTCCCACACATCGT
CTCCAGCGCGAGAACTCTCAGTGACCCTAGCGCCGCGCTCCCACGTTGAGTCTCGCTCATTGTGTCGGTGGTCGTCCCTCTGCTGCTTGGGGGCCTCGTT
CTCCTCTCCACGAGCTCCGCGTTCCTGGTGTCCGCGCGCGTTCTGGGCTCCTCCAGCGGACGCGTTACCGCGTCCACGTCCCCGACCGCGGTTACGATTA
AGCGACCACTGCTTGTAGATCTCCTCGTAGTCGAAGGGCAACGTGCTCACGGGCGGCA