Description :
From Genome Similarity Track
Location :
Scaffold_13:291723- 294836
Transcript NameFunction/comments
Hyaar_Emoy2802441hypothetical protein

Sequence
3113 bases(100 bases per row)
TCATGATCCCACCGAGGAAGACGGGAAGTTTGTAGCCCAGTGGCGTTTCAACGAGTCCCGAGCCGACGGCAAAGTTCAACAATTGACCAAAGCAATTGGC
CGAGTTCAACGCTCCGACATAGACGCCAATCTCTTTATCGTCGCCGAAAACGTGAACGATCACAGGCACAATGAACGCAAACCACGCGACCTGTGTCATG
CTGGTAATGACAACGACAAACACGTTGAACGTCACGTCGCTTGTCCACGCCATGACCATAAGTAAACTCTGTGGAAGAGTCGAAATAGTCAGCACCCACT
TCACGCCAAACTTGCGCGTTAGAACCGGCAGCGTCCAGGAGTAGAGATAACCGGCAACGTTGAACAGCAGATCAGCACGGCCACCGGCAATGCTGACTCC
CTTGTTATAGGCATCTTGCTCAGGACTACACGGGTTGCAGCTATCCGCATTTTCAGCAGATCCATTAAATACCTCCAGGCCAAAGAACTGACCCTTGTTG
CCATTGTACGCCGTGAAGCCGTACTGGACGAGGAATAAGCAGAGACCATAGACCGCAAGCACACCAGGAAGTGTGCGGATGCCGCGATAAACAGACGCAA
AGGCATCTCCGATTCGCTTCCACGTCGAAACGTCCTCGACCTTGCTTGGGTCTAATGGTGTTTCTTTAGCAAACACAACAGCAACAGCGATGCACAGGAT
CATCGTCCCCGACAGCATCCACATGAACTCGTGCAGCGATTTATGAGCAGCACCAAAGAGCTCAATGTAGCCAGCGACAAGGATCGATCCCAAGGTCGAC
CACGCCTGGCCGAACGCAGCTCCCGTCGTTTGTCGATCGCCAGCAAAGTCAGCAATTAAGAGCATAGCTGGCGTTTGCACGACGTTGACGGTGATGTCCA
TCCACAAGTAGAAAAAGACAGTGAGGATCGACGTCCACGTGCGACTAGCGGGTTCACCGTCAGGCCCTTCACTGTGGTCCCCAAGAGCTTCGCCCATCTC
ACGGGTGTAGCTCATGGCAATCCAGCACATGATACTCAAAATGCTGGCGATCGCCAGAAAAGGTCGTCGACGACCAAATTTGCTAGTGCTACGATCACTA
AAGACACCGACACTAGGGCCGACGAGCACCCCGACAATGGGACCTACGAATTGCGTCACTTGGACGGCAAAGTTGGGCAGCATGGTGGATAGAAAGGGGC
CGAGGGCTGCCCATTGAGCTGACCAGGCCATGTTGATCGCCATGCGCGGCATTGACACCGCGAGCAGTAACCAGATCGAAGGGTGGGACACGTACGATGA
CGTGCGTTCATTGTCGCCGCTTTCTTTCCTGATCCCAGGCACGGGCGAGACTTGAAGATCGTAATTTTTCGCTACATCGCTCATCGTGCTGAACGATCGC
AAGAGAATGGACGCTGGAGGAGACTTCAAGTCGCGCGGACACGAGAGTGCTAATTGTAGAGTGAGAAATTTTGCAGGAAGGGTGCTGACCAGGCGAGGAC
ATAGCCAGAACCCACACGAACGTTCGCACGAATAAACGTTCGAGAGCTGGTTTGTGCCACGGACTGTCCGCAGTCATGTGTGACAATTTCGATGGTTTGT
AGCCGTCGAATAAAGCGCTATAAATGCAGGATAGACACGGGCTCATCTGGACCGAAGAAGAAAATAAGGACAGTACTTTTCTTAAACTTGAGTGATCGAT
ATGGACACGGTAAGAGTTGCACCCGTATGAAGGGAATGCTGGATGCATATCGTCTTATTATCGACCGTATGCCACTAAACACGTGTAAGAAATTGAAAGC
GTCTGTCGCAACGAACTTCGTAGCGTTGGCACGAATCAGAAAAATAGTGGTTTCATTTCCGACGAATCTGCTTCGCATCCAGATGGTATTTTGACCAATC
ACCATATCTCGCGACGACGCATCGGTATGTTTCGGAAAGAGCAGAGAATAACGCCTCAAGGTGAAACAATTTTTTGTGAAATATTGGTGTGATGCATTTG
TCTGTGTAAAGCCTTCTATTCACCTTTTGTAAGAGCATCTGCACATCGATGTGGTACCAAGTGATGGATGTGCGATGAGGGTACTGTTGTCGCAAACCCC
AGGGCTGCACATGAGCACTTGGTCAGTTGCTGCTTGCGATAGGGTCGATTAGCCGTGCAAGCTTTCCTCGATCGGACACAATCAAAGTGAAGTCTATACC
AGCAAAGTGTTGATGTCGTGGCCAGTTTTGGCAGTGTGTGACTTACGCCGAACGCACCTTTGCCACGTCGATAGGATCATGGGCGCTCCACAAAATGCAT
CTCTGCCTGAGATGTCATACATTTTTGCACGTACTTCATGCGATTCTGGGCGTTAAAAGGTCAACCTCTACCTGTCTACCTGGGATGAGAAACGGCTCCA
CACGATGGACGCGTGAAACGGGCTACTCGTTGGCGGGGACATCATGCCGGATGAACTGACCAGCCAATGAAACGTTTCCAACCAGGAAACCTCCATCGCT
GAAGTCCGTCAAGTGTTTGTGCATCACACAGGCAACCATGTGGTGGGGATACAGCTGGCGCCTCCTCCGTCGGTACATGTATCTAATCTACCTGTGTGAA
TGTGGTGAAAGATTCATCGCATGCTGGATTTCTATTCATATTGGCTGGAGAAAACTGCTGTCGCGATGTCATCCAAATCAGCTGCTTGCGCAGACAGCGG
GAAGTCCTTATTTGCTTCACAGCCTTGCGATCGAGTGTCACCACAAGAGTCGACACATCTGGCTTGACCCCTCTTGTTGAAGACTTCTTAAATATACGCT
TTTCACCACTTGTTCCACCCGTGATCAGGTAACTAAACAACGTCGCAGCTGGAAGGTTTCTACATAATTGTAGAGCTGCAGGTAGGAAAACCGTCCAAGG
AGACGGCATGAGGAGACTTAAGCTCAGCTCAGTTCAGTTCAGCGTCTATCTGTGTTATAACGAGTCATTCCAACGCAACCACGATTACAACCGCTCCACT
TTGTGTGAGGTCATGTTAATTTTTAGCTGCAAGACGACGACGAGATACTGTCGTCGTATTGAGCTAAAAATTGACGGGAAAACATCAGGTGCATTAGGGA
TCACTGAAAATGA