Description :
From Genome Similarity Track
Location :
Scaffold_100:29172- 34557
Sequence
5385 bases(100 bases per row)
GGTTATAGCTTTAGCGCTTAGTTACAACGAGGAGTTTACTTGTCCTTTTGTGTGGCACAGCCATGTAGTGCAGATATTACGTTCAGCATATAGCACCCCT
ATAAACAGCAACAGCGGATTCGATAATCAAGGTGCATCTATGAGCGAACGCGACATGACGAATTTCGGCGCAAAGTTTTTCATATCAAGGTTCGATAGAT
ATATCCGTCAAATAAAGTACACTATAAGGGATTTGGTCTTATGACACCTCATTTCGGTATATCTACACCAATCCATACAATTCGATAGCCCTAATTCTAG
TATCGCAACACTACTTTTAACGTAATGATGATGCTAATAAGTACTCAGTTTCCCACCATGACGGCTGCTTCTCCCCCGGAGCACGTTTATAGATCCAGGG
GAATGATGAAGAGGCAGTATAAATCTTTGCATCGTATGTAAATTATTTTAAACAAACAGTTCGCACGAAGAAAATTACGAGCGAAACTGTCAGGAAGGTG
TGGTTTGCTTTCGTCCATAATGGTGCGTACAAAACCAAAAGTACAAAGGTTCGCCAAAACAAACCCGGCAAATGATGTACCCATGGTAAGTGGCCATTCA
GCTCCTACTTAAGCAATATAATCCACAAGTGCGGGGAGCGAGTATGTCGTCGCAAATCATAGCCATAGGGAAGGCCTAGAATCTTCCAGCAATCCAAGAA
TCCAGGTAAATGCTAAAGCAGAAGATTCTGGACATGACGAAAGGTGGGAAACCTCCTCGTTTGTTTTGAGTATTATGAGGTGGTCTGATCCAACTTTGCA
TGCCAGGTAAGACATTACAATGTATTAAAAGGTCCAGAGCAAAATTTATTTTTGTACTTAGCCCTATAGAAGCTCTGCTTGAAACACTGGAGGAGAGTAC
TGTTTGGCGCGAGTTATATTGGAAGCCTTCATCGATTCAATGTGCGCGGTGTATACATGTATCGATTCTTCACATGGGACAGTCATCTAATTGGGTCATA
AGTTATTATACAATTTTCGCTAACCAAATTTGAAGGAATGTGGCAATACTAGAAGGTGATATTTGAGATTATATAGATGTGTGGATGTACCCAAAGTGAT
TTTTGGCTCTACCTGTTCCCAGACTATCTTAATACCTTATTAAAAAGAAGACAAAAGTAATCGAGCTTTTTTATTGCCCTTGATTACGATCAGAGGATTA
TAGATGATTACAAGGAATAAGTATGGAATTCGGTTAAGTCCCTCAGCGATTGAGATTCTTAAACACCTTCTCCAATCTCCAAACAAGATGATTTGACAGC
ATGAGTCATGAGCAACCTCCTACGAAAATGCTCATCATATATACATCGGGATTGCTGGGGTTGGCCTTTAGGTACGCGACGATATACGGTAAGGTCGTCG
TGATGTACATATATAACTTCTGACGAAAAATTGTGCTTAAGAGAGCTTACCAAGCTCAACAACGCGGTGGATTAGGTCTGGTAAATATCAATATGTATAG
GACAATAATTTTAATAATTTGAAAAGTGCTATTCATGCGTCGTTTTTGCTGTGTGTAATATCGATAGACAATTATGGGTGAGAATCATAAGAAATATATG
ACTTGAAGCGTGTGATGTTGGTGACTGTGTCTTTTGCGGGTCAAATTATGCGTCATTGGGGGTAAAAGAAGAGAGATTTTCACGCTGAAGAGTCTACAAC
AATAGCTGCTAGTTGACAATGACACTAACAATGTGACGCATTAATCACATGTGCGATTTTTTCCTTTTAATTATATATATTATTCATTCGGTAAGGACTG
ATCGCTATACTAACGGAACCGCAATAACTATCACATATCAGGAAATCAATCATATTTCTACTGAAGTCAAACAACTAAATTTATATCAAGTGAAAACTTA
CTTCTGCTGTTGCCGTTAATCCTCACGTACCTGCAATTTTTGAATTCAAGGAAGAGGCGTGTATTGTGACTCGTCTCTCGGTATAACGACACCATAAGCG
TAGCACGGGAAAATCTCAAATTGGTAATAATCAACAGCTTTTATGCTTATACCTTCCTGATCTCTTACCCTATTTTTTACAACCACAACGTATCCTTTGT
TGTGCATAGGCACCAACAGCTATCTTTGCTTGGTCAAACGAAGCTTACACAATCTGAGGCAGTGTTGCCAATTTTCTTATTAATGTGCGAATAATACAAA
AGGAAATCCCCCAATCACCTCTACCTTGTTGTTTCGTCGCCGGTAATATTACTTAATTAGAGCACAATAATCTAAATACGACCAAAAAGGAAATCGATCG
ATCAGCACTATCCCAAACAGACTTGACTGCGACAAATATCAGTTTCATTTGACAGATTCACACTAACTAAAAGCGCTTTATCTTTCTTCTAAACGCAGAA
TGAACAGATGAAAAGCCGAAAATACATGTTAAAAATGAGAAGACACGCCATTCTTGCTGACGTCTGCGGCCGGGAGGGTGGATGCGGAGATTGAGAGTAA
TTCGAATGCTATGAAAATTCGAACGAACGGCATTTAGGGAGCAGTAGAAATACGTGATAAACCTCCAGATCCTACAGTAACGCAAAATTGCCATTAATGG
CCATGTATGATGCGCCTCGTGAGAAGGAGATACGAAAGCGATAAAATGCAAGACTGAGGCTCTAAAACAGAAAAAGCGCACCACTCTGTTTATGGTATCA
ACTAGACTTTTCTTAGAACTAGGGGCAAAGCCTGCATTTATGTATTTGCAGGACTTTTATTTGACAACGTTAATGACTACCAATATCGTTAGAGAAGGAC
AAAATCGTCTGAGCATAGGGTAACTGCTTCCTGCGAAAACATAACTAGTCTTTAGTCAAATAAAACCTAAGTTATAGACGTACACAATACAAAAAAATGA
CTATATATAGAAGCGAAAAGATGGTCGTGGTTTGAGAGATTCCTGCTGGGGTTACATTAGGTGACGCGCAAGTGGACAATCGAGTCTACGATCGAGATCC
AGATTGGCAAATTTATCCATTCACAGCTACCTTATAATAATATCGGAAAGCTCACATTGTCATGACGTATCGTTTGGAATTTGATGTCAAGGTCGGAGCA
CGCTCGTCACAGTGTGTAAGAACTTCAATCAGCTCCCTGCTGGAGCTTAAGCCAGTTCTTGTACATTTCAAACCTAGAGATGAAAATGAATACTGAATAC
ACCGAATCGTTAGCTACTATCCCTAAGTCGCCTAACTGTCATTAACGGTCTCAAACCTTTCCCATTCAACTTTCCCATTTATAGGACCTTTCCCACATTG
CAGCTCTCAGCTCTCTTTTCTTCTCTTCCCAAATTACTGTTGTTCAAGTGTTCGTTCTCCCTTCTTGAAGTTTTCTCTTCGATTATCAGCATCTCCAAGA
CCGAGTACATACAACAGTCGCTTCAATATCTTCTTTTCTAAAGCTTTAGTAAACACATCTGCGGAATTATGCCCTGCCTTCGCCTTGCTGTAATGGCTCC
TTTCTCGACTTGTTTGCGCACATAGTGCCATCTTAGTTCTATGCGCCTTGTTCTCCGAATGTATGTGGGATTTATAGCCATTACATAAGCCACTTGACTG
TCAATACCGATGCGTTATGATAACTACTTCTGTGGCAGTATATCTTGCAGAATATTTCTCATCGCAAGTGCCACCATGGATGCTTCACACGCAAGTGCCA
CACTCTCAGCTCAGCGATTGACAGTGCAGTGATTTTGTGCCGGCGTGACGTCCACGCGATAGCGCCATTCAATAATATACATACAAATCATGTAGTGATT
TTCCTCTCCTCCAGATCATTGGCCCAGTTGCTATAACACAATCTCTTCGCAATAATATCGCCTTTTGGCTGCTGCTTCTTTCACATGTAGGTGATTCTGT
AATCTGGCGCGCCAACTGAGTAGTGCAGAACTCGTTTTCACGGCCCTAATATGCTTGGACGCATGACAAAGCGAATTAATTAACCTAAGGCGAATGCCGA
AACAGGTCTCTTCCTGGTGGCCAGGTACATGGGCATCCCGACTGCCCCTCGGTACAGAAATTTCACATTTATGTACTCATTTTCACTAGCTGGGTTGAGA
TGAATATTCACTCTTATGGGGTTTACCACAGCATGAGCGTCCACCTATTTACATAATGCTTAAATTTCGCGTGTATATTTGCATTGCTCAACAGAGAATC
TGCTCCGGATTCTGCTCGATCTAGTGCTAAGGTAGTCTGTGAGTAAACCCTGATCTACTATTCCATACGCATCGTTCAAATCCATGACAAACATGCTCTT
GCACTGTTCCTTATTCTTTGCGACGAATAGGTCATCGACGTAGACGAGTACATTCAGGAGTGTCTCACCCTTTAAACGATAGTATAGACAAGTTTCCACC
AAGAATTGCTGGAATGCATGACCTCGCAACCACAGATTTATCTCGGAGTTCCAATCTCGCCCAGACTGTCGCAGTCCATATAGTGCTTCAAAAATAACGG
ATATGTATTCATCGTTGGTGCACGGGTGCCCATCAATTGATTGTAAGTACTGTCGAATCCCAAGCGGAGCATTTTAATATGCAGTGGAATTATGACATTC
GTGCCACTGGTGCAAACGTTTCTATAATGTCAATACCGGCTCTTTGACAGTTTCCCATCGCTGCAATTTGTCCTTTTAATCTGATCACATAGCGCATTCG
ATCATACTTGATAACATAGACTCGCATTGTTTTGACTGAATGAGCGTTCGTGAACCTTCTTCTCTTAGAGTTTCTTTAAGAAGCCTTTTTCTCTGACAGC
TGCCATCTCGGTAATTTCGGCCGCTTTGAAGAATTGCTTTCTTGACATATTAAGCTTAAATCATGATAATGAGAAAACAGTAGATGATCGTCGGTCATCT
AAATATATGAGGTGATTAACGTACCATTTAGCTTAACCCAACATTTAATTTTTGAGTATGAGCATACAGCTAACTGTTGAGACAGTTACCGTTGCTCAGC
AGTGTCGTCGCGCTGGAAACAAAGAGCAAACGTACATTAATGGATGAGTCATTCGAAGAAGATAAAACCGATGGAAACTGTATCATCATCGAAAAAGGAT
GCTTATTAGTGGCTTGAGTGGTAGAAGGGGACAAAAAGAAACGATTTAATGATAGATAAATGAAAAAACTGATATTGTCGTAGTCGTGTCTATTTTTTAC
GCAGCGGCGTCCGAGTGATTAACTTGTTGGTCTAATTATGCATTATTGGGTCCCAATTAGATAATAAGCCGGTGGCGAAACAACAAGTTACGGTGATCGA
GTTGTTGTCGATAAAAGTTTAGCTTAATTATAAATGCAGTATCACATTTACCAACAGCAGTGTGTTATTTATATGTTTAGTTTTG