Description :
From Genome Similarity Track
Location :
Scaffold_6:291713- 292717
Transcript NameFunction/comments
g865.t1hypothetical protein

Sequence
1004 bases(100 bases per row)
TACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATG
GCCCAATGAAGCGCGGAGCAAGCAAGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTGAA
TTCATTTGTGTTTCCCCTGCCGGTGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAAACCGAATTACGGCTTGTCGA
CGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTCGTTTA
AAGTGTCTACGCCCGTCGTAGACACTGTCTTGTTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGT
GCTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATT
CACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCA
TAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAACTGCGTCCAAAGAA
GTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACTATGGTGTCTAAACACCAGGTCAACAAA
CAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGC
TTGT