Description :
From Genome Similarity Track
Location :
Scaffold_1361:2917- 8064
Transcript NameFunction/comments
Phypl_g13214hypothetical protein
Phypl_g13215hypothetical protein

Sequence
5147 bases(100 bases per row)
CAGAAGTTAGTGCTCGATCGGCACGCACTGCTAGGAATTTGGTTAGCCCCAGACGCCGTACCTCGCATGCCAGGATTTGTGTCAGTCGGATCGCGCAGAT
AGATTGAATGGCAGAACATCGCGTTCGAGGCTACCACTGAACGACAGGAGGAACCAGGACCCGAAGAGGAGCCAGTGGGACCGCTGGTAGATCGGCCTCG
ATatccgacgccgacgcgaaTTCTGAGTCGGTCGGATGGGCCTCCTAAACCAGCGGTGGCCGTAGCGACCGCCTTACCATCACCCTGCGAAGGAACACGG
GAAGGCCCGCCGGAAGCCGGGTTGAAGTGTGAAGAGCCGGATGAAGAGCGAGTCGCCCAGGAGCCTGCACCGATCCGGAAGGAGGAGTCGACTGAGCCAA
GTCATGATATACCGAAGACCGATGTCGATCCTTCACGGGAGTCGATCTCGGATGGAGCTAAAGCAGAACAAGTATGCTACCATGAGGGAGGAGGATTGTT
TGCGGAAGATCTCGAACAGAACTTCGTCATCTTGCCCGAGGTAGCAGCTTCGACCGAAGAAGTAACGATCGAGGACATTCAGGTTGGCGACCCCGGTCTG
AATACCCCAGAAGAGATCGACCGGCTGCGACGGATCATctggcgaaggcggcacTTGCTGATCGGCAAAGGGAACGCACTGCCACCTGCCGCACACGGTG
CAGTgtgcgacatcgacgtcggCGGAGCTACTCCAGTAGCCCAGTGTGTGCGACCGGTTGCTCCGCAATTTCGAGAGAAGCTGGCTGCGCTGATCAAGGG
TCTCCTGTCGACTAGGATCATCAAGCACTCAACTTCGCCGTGGGCATCCCCGATTGTGATCATTATCAAGAAAAACGGTGCTGATATATGACTCCGCATT
GATTACAGAGTCGTGAACGGTCTGACGCGCTTGATGGTGTATCCGATGCCGTTGATCAACAGTCTCCTGGAAGACTTGGATAAGATCTTGTGGTACTCCT
CCCTTGACATGGCGAGCGGATTCTAGGTAGTCTCCATGACTGAGAGGGCACGGTTGATCTCAGCGTTCATCACTCCATTTGGGCTGTTCGAGTGGCTGCG
TATGCCGTTCGAACTGAAGAACGCGCCTCAGATCTACCAGCGAGTCATCGACAATGCTCTGTACGGACACTTGAAGATCAGCGCGGGTCCAGACTTGAAG
GAGACGAGTGACGTCTTCGAGAGTGGCGAGCCGGACACCGATCAGAAGCCATCCGTCCTGGGGCGACGATCgtacatcgacgacatcttGGTGACGGCCG
AGTCTTGGGACACCCTCTGCACGAACGTTGATCGTCTGTTGGATGCTTGCGAGCAGTGGAATCTCTCGATCAGTGTCGTCAAGAGTGTCTGAGGACGCCG
GAGGGTCGATTATTTGGGTCATCAGGTGTCAGCGGGTGGACTGGAAGCCCATCCGAAGGATCTCAATTCCCTGGTCAATGTCCCGTTCCCGCGTACGCTG
CGATCGGTGCAGtcctccttgggcagcttgaACTACTACAGCCGCTTCATTGAGGATTTTGCGATCTACGCGGCGATCTTGTACGAGCTGCGAGAGGTGA
ATTTCCACGAATtccgtggacgagaagccAGCGCGGCTGGGGTTAGAGAGACCGGGGACGCTGGATCATCTCccgaagaaggcgatcgcTGGGTGAGAGC
CACGATCGCGTTCACtctgctgaaggcgaagatcGGCTCTACGCCGATCCTCCGTCACTTTGACCCGGATCGGACCCCAGTCGTGGTGGTATACGCCAGC
AAATGGGCGATcgccgcggcgctgatgCAGGAACATGATGGCGTGTACTGACCGGTGACTTTCACTAGCCGTACCTTGAAGGCGAACGAGATCAACTACG
GGATGGTCGACAAAGAGGTGTTGGCCCTCCTCCGAGTCTTGAACGTCTGCTACACGTTGCTTGTGACGCGATCGATAAAGGTGTTGACTCGTCACTCGAC
TCTGGCGTGGCTGGTAAACCCCCCTGGATTGGACGGCAGACTCGGTCGCTGGGCTGCGTTGCTTTCCGAATGGATGCTTGAGATCCGAAAGTGTACGAAA
GGAGAAGACGAAATCCTTGGTCCGATCGCGGCAAGCATCACGCCTTGGTCTGAAGTCGATGAGACGTTGGTCGCAATCGCACCGAGGAAACAGCCACGTC
AGGTGGTCACTATGCTGCCACCGACAGTCGAGCTGAATGAAAGTCTGTTAGTCTCAGCTTCGACGGATCTGCGAGCGTCAAGCGGAAGGCCGGAACCTAT
AGCGCGATCATATGGGAGCTTCCCGACTGGACGATCATCGCTGCGGCTTCGAAATACACGGCCGACCTGACATTCAACGAAGCTGAGTACCGATGATTGC
TGCTATGCTTCGATCTCCTGTCCGATCTGGACAGGGGGCGACTGGTCTTGTGCGGAGACTCCAACTTGGTGACCAGGCAGATGCGCGGCGAGATCGACTG
CAAAGCGCCCGGGTTGCTGTTGTTACGACAAAAGGCGCTGGAAAAGTTGAGGTCATGACCGAGGCACGAGCTCTTGCACATGAGGCGTGACTTGAATCAA
AGCGCCGATCGGTTAGCGAGTGCCACGTTACAAagccaagaaggcgcagtCGTTACCTCGGAGGAGGATCGCCAAGACTTGATCACTCTCAACCGACTTG
ACGAGTTGCTGAAGCCGAAAGCGATCGACACGGTCGTCCGCGTGAGCGCCGTCACGAGATCGGCGAGACGACGACCCCAACCATCAGAGGTCCTGCAAGA
AGAGATCGTACAACGCATGAGAGGCGAGCGGATACGGCAagcgcaaggagaagaaaAGTGGATCGCCGATCTAAAAACGTACTTGAAAGGCGACGTTCAG
GAGTTATCCGCCGAAGACGCCAGGTCCTGTTCCAAGATCGCAGCTGACTACGAGCTGGATGAGAACAATCTGTTGTTCCTTTGTCCCGCAGTGACGCCGA
GGAACGAAGATCGTGACGCGGTCACCCGACTAGTAGTACCGGAGaccctgcagcaggacgtcTTGCATCATTACCATGCAAGTCTGGAGGGGGGCCACCA
GGGGATCGGGCGGACGTACCTTCGCATCAGATCGCACTTCCACTGGCGAGGCCTATACCGAAGTGTCCAGTGCTGCGTGGGAGAATGTAACGATTGTGAG
ACCGGGAATTGATGCCCTCTGGTACAGGGCAAGTCCCCAGGGAACGTGCGAGCAACGTACCCGTTCCAAATCATTGCGATGGACCACATCCCATCGTTGC
CGAAGTCTTTCAAGGGGAACACAGAGTTGCTGGTTTGGGTCGACCTGTTCTCGGGCTACGTGATCGCCAAAGCAAGCGCCTCGCGCACGGCTCAGACCAT
CGCAGAGAACTACGAGGAATGCGTGTTCCGACGTTTTGGGGCCAGTGAAGCGATCCGCCACGATCGAGAACCAGGGTTTATGTCTGATTTCTTCCGTGCA
TTCAACCTTATGGTCGAAAAAAAACAGAGGGCCACGATGGCCTACCGTCCACAGGCCAACAGAACCGCGGAAAGGATGGTGCAGACGTTGACGCGCGCGC
TCAAGATGTACGTTGCTGATGTGAACCAATGAGACTGGGACGAGTATGCGGAGCGCGTGACATTCGCGATCAACACTGCCCAAGATCGCGTCAGGGGCGA
CACCCCGCTTTATCTGATTCACGGCTGGGACCCGCGTTCGACGTTAGAAGCTTCCTTACCACTGGGCAGTacgcgacgacgagacaGCGAGCCGAGGCAG
TGGAGATAtcacgtgcagcagcagtaccaaAGAGCTAGGGAGCAGGTCAACGAACGCCTACGAGAAGCGATTCAAGGCAGGGCAGACCGCCATAATGGAG
AGATCAGGCCGCACTTGATTCAGGCTGGCGCGCAGGTTTGGTTGTACCTGGATCGGGTGAAAGAAGGCTACGCGCGCAAGTTGGCACATATGTGGCACGG
GCCATTTCGGGTGGTGGAGATGGTGGGGAGTCACGCGGTGCGGTTGGAGACTGCGGGGACGAAGTATCGCCTGTTCCCAGTCGTGCATGTGTCCAAATTG
AAAAGAGTTCGGGCGTTTCCGGATCGCCCGGATGTAGAATTAACAGTGGATGAGAGTGCCCGtgtcgacttcgacgaggcccTCCTACCCGAAGATAGCT
GGGAACGCAACCttgacgaggacgagtaTGAGGTCGAACGGATCGCAGACATGCGAACAGGTCGACGTACTCGGTACGGCCGAGTTTATCGTGAATTCAA
AGTATACTGGAAGGGGTACCACGACCCATCATGGGTGGATGAGGCCGATGTAAATTGTGGCGCCGTGTTACGGGAGTACGAGCGCGGGATGATCGCACGC
AACCGCTTCGGAATCATGCAATCGCACGAGGAAGCGACGCAGGACTCGTAGCAGCTGCTGTTATGAGGGGGAGCAGCGTGAATCGCGTACAGGGAGGCTG
TACGTCCGAGGAGGAAGGGCTTTATGTGAAAATGAGTTTGGGGAAAACCAAAAAGTCAGGCTATGTGGGTCTGACGGCATCTGCGACCGGCAACGCAGAG
ATGCGAGGCAAGAGCGAGAAAAAGACGCTGGCGCCCAGCGGGGATACGTGTTAAACTTACGCCGGTGCGTTACCGAGAGCAGGAGATCTGATCGGGGTGT
CAACTATTCGCTGACAAGCACCGTCGGGACGAACTTGTTGACGAGACGGGCAATCTTCGAGCCGGGGTGCTCCTGAATCCGGCCACGATACTGGTTACGC
CAGGGCTCATCGCGGTCGATCGCTTGCAAAGCGGCAGCCAGAGTAGCTGGACGTGGATGCATTTTCCACCCTGGGTAGCACGTCCGAGCTTCACCCGGGC
GAGGATAGTTCAGGAAAAAGGGATCGAGAAGTATATCTAGATCGCATCGTTCAGCGATGATCGCTTGCAacacctgctgcaggaaggaTTTCCAACGGGC
ACCGAGACGAGATCGCCGCTGCTTCCGGCCCAGCCAAAACGCGGCCAAGAAAGGGGAGGGTTTTCGGTCTTTGGATCGAATCGGGAACGCATGCGTCGAC
TCCCACACGGTTTGCCGGTGttcctcctcgatcttgcgATACTTGGT