Description :
From Genome Similarity Track
Location :
Scaffold_706:2917- 7405
Transcript NameFunction/comments
Phyke_g10916cyclin-H, putative
Phyke_g109172OG-Fe(II) oxygenase superfamily protein
Phyke_g10918hypothetical protein PHYSODRAFT_504907

Sequence
4488 bases(100 bases per row)
GTCCGTTAGCTTTGTCACCACTgcttgcagcaacttcgTCGGTTACGTGCCAgagtgctgcaagtgctaGATAAGCCGGGTagtgcagcagcggcaagtc
TGTCAACAGCATGTCGTTGAGTAACGCGCATGAGTTGGCATGAAGTTTTTGCAGAACAGTCGCAGGCAAGTCATTAGACAAAACCTGCTTGGAGAACGCT
CGGAAGTCATCCATGAACCCCAACAACGCACGGAACGGATGATACATAATGAGTTGGAAGCGTACACCTTCCAGCAGGATCATCTCATGTCCAATGATGA
ACTTGTGGTCCACATGGAGCTGGTCAGCCACCGTGTCCACCGATATGTACTGCTCCTCGATTTTACCAGCCACGTAGATAGCTGTTGGAACCATAAATTT
CGGATGGAACTCCATCACACTGTTGCTGAGATAGAATCTCTTAAACAGCAGTACAGCACAGCATTTGACCTTGTCAGATGTGCGCAGGAATTGGGCACTG
CAGCTCTCCTGGATCTTCTCCTCGTAAAAGTCCCGAAGTAGCGTCTCTTGTTCAGCACTAAGGAATTCCAGCAGTGGTGTCAACTGCAGATtcgccttct
cctccacttgTTCTTCAGTATCTAAATCCACATCTACCTCATCGTTCCAATCAAAGGCGTCGCGTGCAGCTGTAGATGAACGTGGCACCAAAGCCGCAAA
GGATCGAGCCTTACGGTTATTGGAGGCGGCTGCATCCGctttctgcttctcctcgcgCTCCAAGCGCAACGCACGTTGGGACTTTAGATGCTGTAGACTA
CGTATACGTGCTAGCTCCTCCGCAGAGAAGACCCAGTTGTTGAAATGAGTCGATGAAGCCAGGTACGACATGCTGCAGATCTGCCTACAATGGTAATGGA
GCTGGCAATAGTCTGGCGCTCAATTAAACTTAAACAAAATAAGTAatcatttcaaccaatccaaATCGTATTATTATTTTGACGAATAACATGTTTGTAC
CCTTAATTACAGCTgatgattggtcaaaacacATATAATGTTGAAGTAGTGACTTCCACGTGATGGCACATCATTCCAGTATTGGCCATGTGGAGCAGgt
gcttgctgtcttcgCGTCGCGCTCTGGGAGCCCGGCACTTCGCGTCGACGCCGCCCCGCGTTATGTCAGCGGCCAAGGTGGGACTTCGCCAGCTGCCTCT
CGTGGACGTCTCGCCGctcgtagctgctgctgatgggACTCGCCAAGTGGCACCGGAAACCAAGGCCAAGATACTGAAAGAGATGCGCTCCGCTTGCATT
GAAGCGGGCTTCTTCACGATCCCCACTAAGGGCGTGCTATCCAGTCAGTTGATTAAGGAAGTTTACAGTCGAGCTGACGAGTTTATCGCTCTACCGGATG
ACGTCAAGCGCAAATACCACTGTAAACAGACCCCCAACGCACGTGGATGGACCCCAATGTTCGAGGAGCCATCGGTGTGTGCTAGCAATATATTATATCA
TACCTCGTGGTGTTACGTCTATAGCACTGATTGGAATATTGTATGTGTGATACAGTATCAGGCAGATGTGGTCTCACACTTGGAAGGCTTTGATCTTGCG
AGGGAGTTACCAGAGACGTTCATTAAAGAAGGGTCGAGTCTGGGACCTAATATCTGGCCAGCGGAAGTACCGCGCTTCCGGGAGGACGTGTATGGATTAT
ATGAAGAGACGACCAAGCTCTCGACGGTGTTGTTCCAAAGCTTTGCTGAAATGCTAAGGTTGCCATCAAACACGTTTCTGGTGCGGCGGAGAACTACACA
ACGGTGTTACTAGTACTACAAGTACTTACATTTCTGTTATCCAATGTAGCAACACGTTGGCGAAGAGGCTGAAGCATTTATGAGGCTGCTCACGTACCCG
GAGTCGAAAACTTCTGTGAAAAACGCAACTGTGGGGATTGCCTCACACACGGATTTTGAGTGTTTTACGATTATCCACCAGAATGGAGAAGGCTTGCATT
TGATGAACCGCCAGGGTGTCTGGGTCGAAGCTCCAGTGTGTGACAACAGGTAAGAGATAACTCTGGCTGATGCCAAGAGCAATTGTGCGACAATTGGTGA
TGTGTTCTACGTGTGCGACAGGCTCTTTGTTATGGTTGGTGACATGCTCGAGCATTGGACGAACGGTGTGCTTGCTGCGACAGAGGTATGATGCAAGCTC
TTTACACAATACAACCGAGCAATCTAACTGGGTAACCTTATTGTTATTTCAGCATCGCGTGTGCAACTCGGAGAAGAAGCGTCAATCCATTGTGCGATTC
AACGGAGCCAATGGAGATACGGTCGTGGAGCCTCTACCAGCGTTTGTGTCTGCGGATAACCCGCCCCGCTACAAGAGGATGACCCAGCGTGAGCATATTG
CTCACCAAATCGACCTCGCGGAGCAACTCCTGCAGAAAACCAAAGCAGAGGCATTCGCTGGCTGAACGACATCCAACATATCCAAGCAATGTTTGGGGCA
ACTGACGTCTATTACGGTAGTCGCTCTCGACAACTTGAGTTCACGCATAGCTTCTAACACCTTCGAATCTACTTCCTCAGTGCTGCAAACTTGTGGAACA
GTTTCTTGGACTCATCGTTACCCAGCAAGTCATCTCTGGTAGGTTTTCGCCCGTGCTTCTTCTCAAAATTCTCACGCCACTGCTTGAGTTCTTTTTCGAC
CCGGGCCAGTTTCTCGGCACGCGTTTCCTGCACAACCTCTACAGGTACGCTGTCCAGCATGGGCTGGCAGAGGACACTCATGATATCCTTCTTGTCTACA
GTTCCATCAGCACGTTTGGTCATCTATTTCATAAACTCACCCGTGAGTTCATTATCAACACTCCTAAAACCATTCCACAGATATCTCTCACCTTCACCAA
CTTCtgctcagctccagcacctccgaGCGGAATCAACAACCCACCACCAGGCTTGAGGTACTCCAGGAACCTCTCAGCTTCAGTTTTCGTTTCCACTGCC
ACACCCACGTGAATGCAATCGTactgaccagcagcaggaaagcCCATGTCCTTCTTCCCAGCACTAATGATGATCTGTGTCTGCTTGTCCGCTGCCTCCT
TGCCTAGATTGCGTTGTAGATTCTCTTTTGAAAACTCCACAAGCTCCGGTACGATATCAACACCCGTGACAAAGCCCAGAGGCCCCACCAAGTGCGCCAT
GGCCGCCACCAGGATGCCCGAGCCGCAACCCACGTCCACCGCCGTCATACCAGGCTGCAGATGCGGCTCCAGAAATCCCAGAACCTGCGCGTGCTGTTGA
GGAGTGGAGATCGTAGCCACAGTCCCGATCTTCAATGGACGATTGGCGTATCGCTCTTTGGAGTCTCGGAACGAAGGAGCGACAAAGTCCCCACGGTCCA
CGCGTCTCAAAGCTGCTTCCAGTCGTGAACCTGACGCTACGACATTCGTCCGGACCAAACTGTCCACTAGCGCTGCATGAGAGTTACCTCCGATCTGATG
TCCGATGCTTGTGCTCACCAAAAGGTCCTCCGAGATGCCGCTAAGCACACTAAAAGACCGGCGACCGAGCGCCCCACGTGTCCATATCCGAATCATGGCA
AAAAATCTATGATAAGGATTAATTTGTGGATCACACACTAATTGGACAATTGGAGATACTTTTATTTAATGTCCGACTATTTTCAGTTGAACTCAACTTT
AACTATATGTTGTATGTTGTTGACCGTCGTTAGAGTGCCGCGAAAGTCCACGAGGTCATCCTCCCGATGACCACCCTGTCAAAAGGTTACGCCTACCAGC
AACGCCGACAGGGAAGGCTTCCTAGAAACGCAAGATAAGCCCTGATGGAAGAGTGCTTGTGCGCCTGGAAGAGTGGTTTAAGCGTCATATTGCTCAAGAC
CTGTGGATGCCTCCATATTCTTCGTTGCGGTCAGTCATGAAGCCTCATCATACATCTCACGCTAGAGAAGGCGGTATTCTATATGAATCCCAGCCCCCGA
TTCACATCGTTTGGTGGAGCCGCTACTCACGTCTTGGTTTAACATAATCCATTTTTCAAGATCTCCCTGAAGCCTTGCAAACATTGAGGCAGCTGTGCAA
GGACGAGAAGTATATTAACAGCATGATCTAGTTGAGGTTGTACTCGACGTCTTTGTCACGTGGCGCTTTCTCAGATTTCCCAAAGTGGGGATCTTTCCCA
GGTTTCGTTGGGTGCATGTTTTTCGAGTGATGGTATCGCTGGTGATGGGTGATCAATGGACAGTGTATTGTCGATCATGTACGTCGATGGTGGCACGCCT
TAGAAATCTAGGGTGGTCCAAGTAATATGGAGTTCCGTTCAGAAGCTGGACACTGGTTGTGATAGGAGTGGAGCTTCCCGAAAAATGATTATTGGCTTGA
GTTGATCCTGTTCTGAGAAGTACCTCAGAATGTATGCGATCCTCCCCATAAACATCTTAGTAGGGTGGAGATCGATAATCGTGTTAAC