Description :
From Genome Similarity Track
Location :
Scaffold_47:291699- 296746
Transcript NameFunction/comments
Phyra_95660TATA-binding protein-associated factor MOT1
Phyra_49456Hypothetical protein

Sequence
5047 bases(100 bases per row)
GCGCTGAATCTCCAGACGGTGGATATCAAGAAGGTGGTGCATGAAGGCGCGCCGTTGCTGCGGAGTGGAGGAGAGGTGAGTTAACTGCTGCCTTTAAACA
GGTGATTGAAACTAACTGAGAACGTGTTGTTCTACGTAGGAATACCAATACGCGACGAATCTGACGGAGGAAGAACGACGTGTTCATGCGGCGAGGCAGC
GACGTCTATTGTTGCGGCGTCTTAGTGGAGCGGGAGGACCTATTTGGAAAACCCGAGAGGACTCACTTACCAAGCAGCTGCTTCCCAGACTCAACAGAGA
TCGTACGTGTTGGAGTGGAGGTCTTTTGTGCGTGTTTACTGATTGGTAGCGATGACTGCCGTACGGGTGTGGTTACCTGCAGATGCACAGGAAATCGCTG
ATGACATTGAGGCGAGCGAAGAGCAACCCAACGTTGGTGAGAACCCTGCCAAAGGTATCAATCGGAAGCAAGCGAGTGAAATGTTATCGATTTCAACAAG
ATCAAAACGTCAGCTAGCTGATGGTGCAGCTGAGTTTGGGAGCAAAGACAAACGGGCAAAAGTAGATCACAACGGCGATGCAAATGATGCGGACATGAAC
TTACCAGTTGGGACGAGCTCTGACGAGCAATTGGACGAGTCGGAATCACAGACCAAGGGTTCGATTGTCGCAAGCTTGGTCTCGGATCTTTTTGAGAGCA
TGTTTGATTCCAAGTGGGAAGTTCGGCATGGTGCACTCTTGTCGTTGCGGGAAATGTTATTAGCTGCCCATTTCACCGCTGCAGTTGAAGCAGTCCGACC
CGCGACGGACGAGAGCATGCAGCGAGGCTTCGTGGACAAGTGGCTGGAAGAATGCCTAATACGGTGTATGTGTGTACTTGCTTTGGATCAATTTGTGGAT
TACTCGGCGGACGGGTCGATCTCTCCCGTTCGCGAGGTTTGCTCGCAGGTTTTCGGCATTTTGCTTGGAAGTCTTTCCAGCCAAGATACACTTGTCGGGT
ATTTACAAGTGGTGCGTACACTGTTTAATGGATCGACATGGCAGGCTTGCCATGGTGGCCTGCTTGGACTGAAATATCTTGTTCGAGCTCATAGCAGTCA
CGCCCAAGCGCTAATTCCTCTTTTCTTTAACGATATCGTGGCAGCATTCTCTCAGCTCGATTCGGAGGAGGATGTTCTAGTTCTGGCCGCAGAAATGTTC
ACAGATTTTGTCCTATACTTGGATCAGGTTGAAAGCATAAACATCACGAAGGCTGCGCTGTTGTTGTGGGGATCTCTGAAGTTTAACGAAAAGGCTGGCC
TGGTTACTGCCAGTATAGTCCAAGCACTAAATGCCTGGTACAATCATTCTCCAGTCGCAGAGCTCTTGCAAAGTGACAGTGCAGTCAGGTCAGCGCTTTG
GGAGAATTTGTCGTACACAATCCCGATGCTCCATCACCACTCGCAATCTGTTCGAGCGTCCAGTGCAACATGTGTAGCGGCCATCTTTTCAGGGGGGTCT
TTATTCTTGAGGGAAAACTCGGTTAGCTTTGCTCATTTTTTTCTGCCGCATTTGCTGCTTCAAATAATTCTGGAAATGAACGAGTCCGTCCAGCAAAGCT
TGCTTGCTGCCTGGAAAAAGGTAGTGAGCAGTCTGTCTACCAACGAGCTGCTGATGACTGTAATTGCTGGAAAAATTCCATTGTGGATGAAACTGTTGTG
GTCTACGGACGAAATCTATTGTCTAAATGTTGAAATGGTGAACTCTGACGGCACTGTATCCGGTAGTGTCGTTAGCGATCCTGCCGGCCGGATAATACGA
GACAATATGTCTTCTCGTGTGGCTTTCGGAGAGGCGATCGGTTTTGCTATTTCCCATGTGCCTCTTTCCAGCGCGTGTATGACTGAATTAGTAGAGCTTG
TCTGCGAGGGTCTGTGTGGTAGCTCCGGTGAACAGCAGTGCGGAGTTCTCGTAGCCCTGTCAAGATGGGGTTTCTTTGAAAAACAACTGAGACAGGAAAG
TCCAGAGGAACAAGCCCGGCGAGCTCGGCACTTGCAAGATACAATTGGGCCCTTTCTGAGCTCGTTCGCTGGAAATCATTGGAGGACACTTCAGCCTGAT
GCCCTGAGCGAAGAAAAATTAGTGCTCTATAGCGAGCAAGCTGGATCGCTGAAACGTGTTATGCAGATGGAAGCTCGAATTATTGAGATATTCTCCTCTG
TGGGTATTGCGCTCCAGCCCTCAGAAAGATCGGGCTCGTCATCTACAGCGGAAATTTCACGCCAGATCGCTGAGCACATTGCTCTTTTTCCCTACGAGAA
GTTGCAAGACCATCCGAACGAATACGAATTGGCTCATTTCAAGCGGCAAGACCTCTTTCTTGCTGATGATCTCGTGCAGCAAAGTTTCTCTCGCTGTTAT
CACCGAATACAAGGTCTTGGTAGCAGTGCACTCTGCGAAATACTGCCAATCCCCAAAAAGAGTGGGTTTCTAGTCAAAGCACTCATGAGTTCGATCAAAG
AAGAAGATGATTCAGCATTCCGCACGATTTCATCACAAACGGTTGCAGCCTTTGTGGTCGATCAAGCACAAGCCCAAAAGAAGTGCGTCGCGAAAATCAT
TTCGAACCTCTGCAACAGCGCGGCGGCATTGGTAGGCGTATCGGGTGGCCCTTTGGATAACATTATTGGATTCAGTAGTTCGCCGGAGAACCCGAGTGAT
TCTGTTTCTCCTGGTGTTTTCAAAAAGACAAAGATCCGAGCTGATGGGGCTGAGGCTGTGCTGCGCAAAATCTGCAACTACGCAGGAGATTCTCTTTTCG
ATGTCTGTCACGCATTGGAGGATGCCATTTCTAAGGCTTGGAACCAACCAAACGTAGACGAGCCGACAATTCAACGGTGCATGTATTTGATCGTCTTAGT
GGCACCGCATGTGAAGAGCAGCGCAATGACAACATGTTTGTCATGGCTTTGTCAACTTGCACAACTGACACAGAAGCCATTTGTTGAAAATCAAACGCGA
GGCATCGTGGCTCATGCCATTGCTATTATTTGCAAGTATGCTCAAGGACATCATCGCAAAAACGCGATGCTCGTCGTGTATGAATCCATCTTCGTGATAT
TTTCAAACACTGGTGGCGCTGACGTCTTAAAATCGGAAGCTCTAGAAGGCGCTGTGATGGTGCTCGACCGCATTGTCCGCTCGCTTGGAGCGGAGTTGAC
ACCGTATGTTCCCAGCTTGGTACACTATGCGATGAAAACCATGAGCTCGCAATTCAAACTTGTTCGAACGTTTGCTGCCGGGGTGTTTGCGGACTTGGTC
CCGTTGATTCCACTTCAAATGGATCTTGAGCTTCATAAATCTGACCAGCTACTTCCAGTCTCGCTGAGGACGATTGTGAATCAGAATGCTGTTTCACGTA
GCTTCCTGGAGAGCTTCACGGAAGGGAAGGCTGTTCAGCATACCAATGTGAAGCCCTGGCTTGCTCCAGAGACCTCTTTGCGCGTATACCAGCAGCATGG
CGTAGACTGGCTATGCTTCATGGCCAGGAACAATCTTCATGGGATCCTCGCCGATGATATGGGCCTCGGAAAGACACTCCAAACGCTTTCTGCCATGGCT
GCAACACTAGCAATGACATCTACAGCCCAAAGCAAACGTCCAGCGAGGCCTTGTCTCGTTGTATGCCCACCGATTATCGTGCATCACTGGATCCAAGAAG
CCAAGAAATACATTCCAGGATACTTCGCATCTGTCATCGACTACTCAGTCCCAGCAAGTGACCGAAAAGTGTTGGGTCACGGCAAAAATATCGTGATATC
TGATCACGGCACGACTTTGATCGTGACTACATACTCGATCCTGCGGACAGACATCAACCGCTTGGGAGATATTGACTACTCTTTTGTGGTGTTGGACGAA
GCACATTTGATTCGGAATCCATCGACAGCGTTATTCCGTGCTGTATCGAACCTTCACGCATCACATCGTGTGGCCTTGAGTGGAACGCCGCTGCAGAATA
ACGTCACAGACCTGTGGGCTCTGTTCGAGTTCCTAATGCCTGGATACTTAGGCGACTTTACTTTATTCCGTCGCGAGTTTGTCCTTCCAATCACAAAGTC
AAAAGAGCGCAATGCAACGTCAAAGCAAAAGGAGCTCGCAGCGATTGCCATCACAAAACTGCACCAAAAGGTTCTGCCATTTATACTGCGACGAACGAAA
GACCAGGTGCTGGAAGAGCTTCCACCGAAAATCATCTCGAACGTGCTACTGCCGTTAACTTCGCTGCAGAAACGTTTGTACTCGCTGGCGTCGTCATCTG
AGAGCGATCCCACAAGCTCTGTGGCATCTTCTCGGTCTACGAAGGTGGCCGAGCCGAAACCATTGACGAACGTGCTAACAAATCTTCAATTACTGCGCAA
GATTTGTGTACATCCAGCGCTCGTTGCTGACAACGCAATCTCTTTGGGGCTTAATACGAAGGAAACGGGGGCCCTGCTTGACTGGAAAAGCTCAGGAAAG
ATGACTGGATTGCGCGATCTATTGGTTGAGTGCTGCGATATTGCAGCATGGACTCAGGAAGGTCGCCAAGGACCTGCAACTGAAGGTGATGACGATAGCA
ATTTTTCTCCTCATCGATGCCTGGTGTTTGCCCACCTGCAGAAGACGCTCGATCTCACCGAGGAAATGATGCGGGACGCATTACCTGGTGTAACTTATCG
ACGCCTCGATGGACAAACACCTCACGCCAAGCGTGCAGACATTGTACAGCACTTCAATGCCGATCCGTCAATTGACGTCTTGCTGCTGACTACGTCAGTG
GGCGGTTTAGGACTCACCCTTACTGGCGCGGACACGGTGATCTTCATCGAGCACTCGTGGAACCCCTTTGTTGATCTGCAGGCGATGGATCGTGCGCATC
GCATTGGACAAAAGCGAACCGTGCGGGTATTCCGACTAATCATGGAGAAGTCACTTGAGGAACATATTCTGAATCTGCAAGAGTTCAAAGAACAAGTAGC
TGCTACGGTTGTGCAGAAGAGTGATGCTCAGAGCAGCATGAATACGA