Description :
From Genome Similarity Track
Location :
contig_60:291690- 293145
Transcript NameFunction/comments
g11204.t1XP_009515861.1 hypothetical protein PHYSODRAFT_343894 [Phytophthora sojae

Sequence
1455 bases(100 bases per row)
GGGGTCCAGGTAGTCCCCCGACTCCATCGGGATGTGCGTGTAGCCCGTGTCGACGAGTTTGAGCACCTTGCGGTTCGTCAAGTCAACGTGTGCCACGAGG
CCGTCGATCGGGTGACCGTACATGGCGTGTGTATTCTCGACCTTGAGGAAGCTGAGCACTCGAATCATGCGGTTACCTTCCTCGCCTTCGTAGCCAAAGA
CTCCGGCCGAGAACTGCTCTCCACGCACCATGTCGAGGTCGGTGATACCACGCTTGGCCAGCGCCTCGACGTAGGCGGGGTCGGCCTTGCAAATCGAGTC
GCCGTCCCAGTAGTCCTGGTCCAGGATCGGGATCTGCCCGTCAGTCTTGGGGTCGAACTCCACCTCCTTGACAACGCGGCGTGCCACGACATCCACGACG
AAGTCGCGCGTGGTGTTGGTACTCTGGTCGAGCACGAGGGCGCCGACCTCACGCGGGATCTCCGTAAGTTGTCCAGCCTCGAACTTGGCCAGTGTAGCGT
GGTCCGGCTCAAACAGCATTACGTACGCGTAGCGCAGCTCCGAGCCGGAGTACCCGGCGTCCGCGAGCACTTGCTTCACTGTGCGGACCTCATCGGCCGT
GACGGGATCAAGTGGGTGCTTGATGGCCTTGGACGGGGCGTGGACACTTGGGGCCATTGGCGCTGGGATGCAGGAATGCGGTCGGAGGCAAATCCGAAAG
TGAAAGACTCAATGCCGCCATCGCGTTCTTCTAGCCGCGTCCGCCATGTGGACGTCATTGATCTAGAGGGCCAAGAGTCATGACCTCCACATGCTGGTTC
ACCCAGCTGGCCCCATACAGCGCCACGAGAAACCCGCGCTTAGCCGTATGATGTTACGCATTTCATGTTAATCTTCATCGCCCAAAACGTCTAGTGATCG
GTCTCCGATGTCAGCGGTACAGGCGAGACCAGCTGGTGATCAAGTTCTACGATTGGTGTTCTGGCGCCTCACGCGCCTCGAGTCACAGCCCGAGGCAGTA
ACATGGGTCCATGTTTGGGTGTAATACCCCTGCGGCTCCACAAGAAGCTCCGCATCAAGAGGAGGCAAGAATACTCTCGGCCGGCGGTTCGATGAAACAG
AGCCTCTTCTCCACCTACCGGGATAGCTCCAGGTTTCCGTGAGTTGCAATCACTACTACATGTATTGGTAGTGTAGTTCGGTTGCTCATTTGCACGTTTT
GAAATTATCCTAACGCTGTCAGTACCATGGTACTACATGTAGTAACGTTGATGGGTACACTTCTTTGCTTCCTCTTCGACAGGTGAGCCTTATCTCAGTG
TGTGGCGATCTGCAGCACTGCAGCACTGGGTCTGACTCTGTTGGCTTGTTCATGCCACGCCATTTTCAAAATAGCATTTCTAATTAACCGTATCATCATC
ATCGATGTCAGCATTGAAGCCGCGCGGACAGTTGATGACGAGCAGTACATTGAAC