Description :
From Genome Similarity Track
Location :
Scaffold_177:29169- 31177
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_177-fgenesh-gene-0.10Ubiquitin carrier protein

Sequence
2008 bases(100 bases per row)
ACGATCGCGCAGCCGAGCTCCATGGACTGGTCGAACTCTCTCTGGGCCCCGTCAACACCTTCCGACTTTTTACACAGCAGATCGTCTATGAAATCGGGCT
CATATTCGTCATCACTGCCTTCATCATTGGCAGCGAAGTCCTCGGGCGGATCTAACCGAGCATGAGACAGGTTAACAGCAAGCAAAAGGCACACACTACG
AATAGCACTCACCAGGTGTGGCGTCCTCAGCTATGGTTGCGTCCGTCATCGAGTCTCGGGGTTGTTCCTCCTCAGCTGTGGTGGTTGAGGGCGGGGACGT
CGCAATTGCAGGTGGAACTGGTAGATGTGGCTCGGACTGAACATGTTCACGAACCACCTCAGGCTCGATCTCCACTGGAGCCGGCTCGCTTGGGAGCTCT
TGATGAGCAGGCTGGCTTGGTATTTCTTGTTGAGCCGGCTCGTTTGACAACTCTTGTTGAGCTGCATTGTCTGATGCTTGACCGGCTTGTGGTTCTGCCT
GCATCCCAATTACCATCCATCAGTCCGCGTTGGAGTGAAGTTTGCCGATCGTGGACAGAGCTCACCTTGATTGGCACAGCAGTGTCGGGCAAATGCCAGT
CGAACTTTGGGAACACAAACTCCGGCATCCGCAACTCGGATACGCGTATCTTACACCTGTCAGCCACCTCAAAGTACCGTCGCCGGCGCTTCCTGCATTC
GGCCATTTGCCGCGTCAAATAGTTGCGGCGGCTCTCGGCTGCAAAACCCCGGCCGTCGGTAGGTAGCTTCTTGAGCGCGCGCCGCGCAGTCGCCAAGCGG
TGGTCCATGACGGCTATCGAGGCCGCGTTGACACGGAAATGGACTGCGATACGAAACAGGTCAGGGTTAACCAGAGTACTTACTTTCAACGCACCAACTG
GACACTCACCTTGAAGACAGAACGGGCACGACGACTTCGCGCACGTCTCGAGGTGGTGAGAGAAGACAGCGGCCGTAACGCACGCAGGGTCGTCACAGTG
CTGGTCACGCTTGTGGTGCCCGCGGTGCATCGCCGCTGCTTGACACTGCTGCTCGGTGCACTTGTTCGCGGTAACACACATCAGCGCGTCCTGGATGCGA
ATAGCAGCGGTCAAGCGCTTCGCAAACGCCGCGTGCACCGCTTGATCCTCGGCCGGGAACAGCTTGAGCAGCGCGTCGAGCTCCATGTCGTCCAGCGACA
CCTGCACTTGCTGTGGCTGAGCGTCTTGAGTGTTGGCTTCATTCTCACCGGCCAGAGCATTGGCCTTAATATCACCGTCCTGAGCGCTAGGCTTCTTATC
ATCACTCTGAGCAATGGGAGCCACCTCTGCCTGGACGTCAGACGGCTTGATCGCGTCCTTCTCCGGCGCAGCGATCGGCCCGGTGTCGCTGAAATCGTCG
CGCCATTCGCTGAACAGTCTCGTGATGCCCGCGATATCCGTCAGCTCGTGCTGCTGCGCGACGCCGCGAGCGTGCCACCGCGTAGCACACGCTCGGCACA
GCTTCAGCCGCTTGCGCGGGTCGCACTCGGCGCACTCGAGTGCCCAGGGCTCGTCGTCGCACCATCCGCACGGCCCCGGTTCCGGCGCATTCGCCATCCT
GGGTTGCTGTTTGTTTCCGATGAATCAAACGTTATTTTGGGATCAATCGGACGTTGGATTGGCGCTCGCGAGGCAACCAGACACGCAGCATAGCAGCGCT
GCACGATCTTCTCCATCAAGATGGCCAACCAGTCTTGGTGGAGTTGGCGACGGACGCCCTTCCCCCGTCAAGACGTACGCTATGTTATCTGTCCTGCAGG
TGTGCTACAGTGCCATGACTCGACTGCAGTCCCCATGAGTCAGCACGGAGGAAGGACCAGCGATGGGAGGATCGAAAGATCCGCAGATGCAACGACACGA
CCAGTTGTCACAGCAAAGGAGGACGCAGCGTCCACGGCCAAGGAGCACGCCCCACAATGCGCGCGCAACCCCATAAGAAGCAGTCGAATCGACAGGTAAA
ATGCAAGC