Description :
From Genome Similarity Track
Location :
contig_60:291681- 293136
Transcript NameFunction/comments
g10731.t1XP_009515861.1 hypothetical protein PHYSODRAFT_343894 [Phytophthora sojae

Sequence
1455 bases(100 bases per row)
GACTCCATCGGGATGTGCGTGTAGCCCGTGTCGACGAGTTTGAGCACCTTGCGGTTCGTCAAGTCAACGTGTGCCACGAGGCCGTCGATCGGGTGACCGT
ACATGGCGTGTGTATTCTCGACCTTGAGGAAGCTGAGCACTCGAATCATGCGGTTACCTTCCTCGCCTTCGTAGCCAAAGACTCCGGCCGAGAACTGCTC
TCCACGCACCATGTCGAGGTCGGTGATACCACGCTTGGCCAGCGCCTCGACGTAGGCGGGGTCGGCCTTGCAAATCGAGTCGCCGTCCCAGTAGTCCTGG
TCCAGGATCGGGATCTGCCCGTCAGTCTTGGGGTCGAACTCCACCTCCTTGACAACGCGGCGTGCCACGACGTCCACGACGAAGTCGCGCGTGGTGTTGG
TACTCTGGTCGAGCACGAGGGCGCCGACCTCACGCGGGATCTCCGTAAGTTGTCCAGCCTCGAACTTGGCCAGTGTAGCGTGGTCCGGCTCAAACAGCAT
TACGTACACGTAGCGCAGCTCCGAGCCGGAGTACCCGGCGTCCGCGAGCACTTGCTTCACTGTGCGGACCTCATCGGCCGTGACGGGATCAAGTGGGTGC
TTGATGGCCTTGGACGGGGCGTGGACACTTGGGGCCATTGGCGCTGGGATGCAGGAATGCGGTCGGAGGCAAATCCGAAAGTGAAAGACTCAATGCCGCC
ATCGCGTTCTTCTAGCCGCGTCCGCCATGTGGACGTCATTGATCTAGAGGGCCAAGAGTCATGACCTCCACATGCTGGTTCACCCAGCTGGCCCCATACA
GCGCCACGAGAAACCCGCGCTTAGCCGTATGATGTTACGCATTTCATGTTAATCTTCATCGCCCAAAACGTCTAGTGATCGGTCTCCGATGTCAGCGGTA
CAGGCGAGACCAGCTGGTGATCAAGTTCTACGATTGGTGTTCTGGCGCCTCACGCGCCTCGAGTCACAGCCCGAGGCAGTAACATGGGTCCATGTTTGGG
TGTAATACCCCTGCGGCTCCACAAGAAGCTCCGCATCAAGAGGAGGCAAGAATACTCTCGGCCGGCGGTTCGATGAAACAGAGCCTCTTCTCCACCTACC
GGGATAGCTCCAGGTTTCCGTGAGTTGCAATCACTACTACATGTATTGGTAGTGTAGTTCGGTTGCTCATTTGCACGTTTTGAAATTATCCTAACGCTGT
CAGTACCATGGTACTACATGTAGTAACGTTGATGGGTACACTTCTTTGCTTCCTCTTCGACAGGTGAGCCTTATCTCAGTGTGTGGCGATCTGCAGCACT
GCAGCACTGGGTCTGACTCTGTTGGCTTGTTCATGCCACGCCATTTTCAAAATAGCATTTCTAATTAACCGTATCATCATCATCGATGTCAGCATTGAAG
CCGCGCGGACAGTTGATGACGAGCAGTACATTGAACGAACAGCGCTCATTTACAC