Description :
From Genome Similarity Track
Location :
Scaffold_190:29167- 33270
Transcript NameFunction/comments
Physo_144490reverse transcriptase

Sequence
4103 bases(100 bases per row)
GTCATGCCTGGGGTATCAGACTCCGTCTACTCTGCATCACGAACTTCCGCTTGGGCTTGGCTCCGGGTCAGAGCGGCTAGCACGCGCGCGCCAAGAGAAA
GTGGTGCGTTGTCATAATCTGGGAACGCATCTACGACTGCTCTCAGTACTCGACGCTCAGCAGTGCCTTCGACCAATGGATCGACAACTCCAGATTCAGA
CTGTTTCACCAGCTTCTCAGGGATGCGATTCACCAAACGCAAATGCGACAGCTCAAGGCGATCATCGATAACCAGTGATTCTCCAGCGGCTAGAGTCCGA
CTCGTGAGATAGTCCGCAGCCTGGTTGAATTCCCGCTTCACATGAATCAACTTCACAGACTGGAACTTCTGACGAACCGAATCGAACTCACTTAACAGGT
TCGGTTGATGACAGTTGATCAACCCTTGGGCCTGTTGAATAGCGATTCGGGAGTCACCGACGACAACCAAGTCGTAAACACCATGCTCCATAGCCAGTGT
CGCTCCTTTGATCAAGCCATGATACTCTGCATCATTGACCGTCACATCTTCCAGGAAGTAACCTCGCGCGCTGACCACAGTCCACTCTGGGAGCTTCCAC
AAGATACAACCACAGCTACCTTGCCTGGTAGACGTCTTCGCAGCGCCATCAAAGCTGAGCAGGTAACCTGAGAAATCCTCTTCCAACATCTCCAGACTAA
TCGGTGGGGCAGGTGTCACTCGTCCTTTCCTTGGAATCAGGGATTCTGCCACTTTATCGAGATGTTCACGAGGCGTAATCCCAGCGCCCATGATGGCTGC
CAGGCCATCCTCGTCCCTCTCAATCCGGTGAATTTCTAGATCCCAAGGCGAGAGCAGGGTGGCCCACCGTTGACAACGTCCCTCCAATGATGACGAAGTG
AAAATCCACCGCAGGACTGAGGAATGAGTGTAGACCTTGATGTGACTCCCAGCAAGCATACAATGAAACACTCGCAGAACGCGCAACAACGCCACCACCT
CTTTCTCACTTAATCTCAGACTCATTGAGGGTTTTGCCAGTGTACCGAACAGGAAAAATCACACCGTCATATTCTTGGCCCAAGACAGCACTTGCAGCCC
AAGGATTCGCATGCAGGATCACAACAAAGTCCTTCTCTCGGTCCGGGTGTCGTAACAGCGGCGTCGAGACGATCTTCTTCTTCAGAATCTCGAAAGCCTC
TTTGGCGCGCCCCAAGTCTCGTCCTTCCCGGACTTGCTCCTCGGTCAGCTCGTAAAGCACCGATGCTATAACAGGAAGATCCTCGATAAACTTGTTGTAG
TAGTTGATGCTTCCCAGAAATGACTGCACGCCTTTGAGTGTCGACGGAAATGGCAAATCATTCACACCCTTCGCGATCTTGGGTTTTGCTCGCAAGCCCT
CGGTGCTGATTTCATGCGACAGGTACGGAATAGACAGCTTCCCGAACTCGCTCTTGGGTAGGTTCACGGAGATTCCCCAGTAGCGCAGTCGGAACAGCAA
CGCGTTCAGGTCCGAGCAGAGCTGGTCCCAGGTAGGCACCCCATGGGCGATGTCGTCAATGTATGAGCTTCTACCCAGGACTGGGCCCATTGAAACTGGG
GCTGGAATGTTCCGGTGGAAAACAGTCATTGTATCTGTCAGAGCTGGGATCTCCACTCCAGAATCGGGGACCGCTCGCTCGTCTACCTTAATTCCCAGAA
ACTCAAGCACATCGGGATCGACCTTGGCTTCTTCCTCAGGCGACAGTCGCACAAAACCCCAAAGACAGTTGTTCAGCATCTGCTGGTATATCAGGGGCGC
ATTTTTCAACCCGAAGGGCATGCGCAACCACTGGTATTGTCCAAGAGGACAGACAAAAGCAGAAATGAGCTTTGCCCTCTGGGTCATGGGCACCGCCCAG
AAGCCACTCGCCATATCCAAGCTCATAAACCACATCGCAGCTTCAAGTCCAGTCAGCAAGTCATCTATCAACGGTAGCGGGTAGCAAGACAGCTTGATGA
GCTGGTTCACCATCCGGTAGTCGATACAAAGTCTGATATCCTTGCCGTTCTTCTTTAAAATGATCACGATGGGTGAGGCCCACTCCAAATGTGAAGTCTC
GATGAGTCCGGTCTCCAACAATTTCTTGATCAGCTCGTAGACTTAGTGGAGGAAGCGTGGAGCAATCGGGCGAGCGCGCTGGGCAATCGGTTTTGCGTTC
CCAACATCCAGGTAGCAGACAACTCCTCTGGCAGGTGCAGGGACAGCATTGCCATCTCCTAGGAAGATCGAGTGATGATATTCCAAGATACCTCTCATCT
CCTTGTTCATCTCAGGAGTGTTCTTGCCTTCGACACCACATCAGCTTCATCCATGTTCACCTTCGGGCTGAGATCCTTCAAGTCTGGGAGTACAGCCAAC
TGGTCTCGTAACTGCGTCAACAGCTCGGTTCCTTCATGGAAGAAGACTTCTTCATCAGGATCCAAGTCAGCTGTGACCACCCGAAGACAAATCGCGTACG
CCACCTCCAGCTGCTCCAGGGCATCCTCACAGATCTTGACTGGCTCTGCGCGAAACACGTTCTTCAATTCATGTCGAGCTTCGGCACTACTGGTACCTCC
ACCAATCAGTGCGGTCGACATCACCAGAATCCCGATCAATGGCGGGCTCCTTCGCAGGATCTAACTCATCTGCCTGCGAGGCCTCGGCTTCGTCCATGGG
AGTGACTTCCGCGGCAGTTGGAATGCCCAGATCCAGAATCTTCACATCAGCAACAGCGCTCGAGTAACTGCGGGCATCTTCAGTCTGACCCGAAGAGTTC
ACGGCTTGGCCACTCGAGTTCCGAGACTTCTGTAGCTCAGCAGCCTTCCGGACTTCTTCAGGTGGACGTGGCAAAATCTTCGTCGGCCAAACATATTGAG
GCCGCAGGACTGCGGGTGGGGCATTCCGTTAGGCTTCAAGTGCTTCCAGCTCCTCCCGTCGCCGATACTCCCGCGAAGGGGTGTTCTGGTAAATCTCTTG
TTGCCACTCTCGATACTTACACGACTTCGGTTGAACAAAGCGGTCTCCTCGTGGCAGTTGCCCAGGCCCCACCAACGCTGCTACCACCGTGTGTTGCATG
ATCTGGGTCCACTTCTCTGAGATATTGACCACACGAACTGCGGCAGGCCGCCGTCTGGAGCTGTAGATCACTTGCGTCACCCATTGATTCCCTCGGGCAG
TCCATACTTCAGCTGTGTCAGCGTCAGCTTGGCCATACCGTACCGGAACAGTGATCGAATCACCAGGAGCCAAATACACCGGCTCACGCACACAAATCGG
AACTTCCAAGATGTAACGTGGAGCTTCCTTCTCTCCAACCAGAGGAATGTCTTCTTCATTCGGAAGCTTAGCCAACTGCTCACGCGCACACAGTCGTACT
CCAGCAGCTTTCATGAAATCCATACCCAGCAGACAAGTGACTCCATCTCCAATGTTTCCAACCCACATGTCCAGCACATATACCACACGCATTCCCAGAG
TTAACTTCACTCGAGTCCGCGACCGGATGTACGTGATCACTCCTCCCATACCTTTCACCTTGAGTCCGGCGTGCGACGTCAACTTAAGCTTCAACCTGCG
TGCAAGGTCTAGGCTCAATATAGTTGTGCTGGCGCCGGAATCTAGAATGATGTGTGTCCGATAGTTGTTGATCGCCCCATGCACTAATGCCACTGCATCT
TGATTATCCAAGTCGTGGTCTGCCCACCACCCGTAACGTTCTCCTGGGTTCAACGTGAATTCCACTGGGGCTTCATCTTCAAATGCAGAACTTCGGAAAA
CGTAATTTCGAGAAACCGGGCGCGATTCCAACAGCGATTCATCTTCACATGCAATGGCAGTCATGCATTGTGGGTTACCGATCTGGTGCCTAAGTTCTGG
ACCGACAAATGCAAGAGCGCAATACGCTTGGGACTTAGGCTCGACACGCACTGGGTCTCTACCCAGCGAGCCTAGTTGTTTAACGACGTCCCAGACTTAG
CCAGCTGTTCTTTCAGCAGTTGCTTCAGAACTTCGGTCGGCAAGTCTTGCAGCGCTCCTTATCGCGCCAATTCCCGGACTGCCTTCAAAGCAGCCCAATC
GGC