Description :
From Genome Similarity Track
Location :
scaffold_398:29167- 31383
Sequence
2216 bases(100 bases per row)
CACCACCTCTATTGGAATACATCGAGAAGAAATTCAGCCCGGCCAGGTACACTTGCACATGGGGCTTACCGTTGTTGGTATCAATCTACTTCTAATAGAT
CCGTTGGCGCCAAATTTGCTTCCGCTCCTGATGTCTGGAAGCAAAAGCATTGAATAGAACAAAAACAATATGAACTGCCAGACACCGACTGACGGAGGTG
GTCCCCCGATGATCCGTGATCTAGCTGTGTGTAATATTCCTCTTGTGTGCCCGTCGGTAGGCGGGTTCCGCTCTTCCAGGTGACTTCTGAAGAGTCTTGC
GGTGAACGATGAACATCTTTGGTGTGACGCAGGGGCTTGAGGTAACCTGGCAATGCTTCACTTTACCTCGGGGTACTTGATCCGGGTCGTAGGCGAGTAT
TCGAGCCTTGATCCGGTCGCCTGGTCTTGATCCAGGTCTTGTAGGAGTCCAATATCGGGGATCTTGCCCCTTCCTTTCCGTTGCTTGCCGCTTCCTTTAG
CGCGGGTGTTGAGAGGGTGAGATTCGACGTGATCATCAGGCCAAGCAATCAATTCCTTCCGATCAGGGCTTCGCACTAAAGGATAGATCCTAGATAGGGA
AAAGCTGGCCAATATATCATCCAGACTAAACCACTACACTAGATCACGTCTCCTACTTTCCAACGTCTAGGTGGGCCAATGTAGTTCCCGATTCTAGGCG
CGGAAGAAGACACTTGTGTGGTTCAGAGCAAATTTGAGTCTGTTTCTGGATATTCCTATCTCCACTAGTCCGATCCTGGCACACTATCTCACGACCACCT
GACACCTGGAGACACAGCTGGAGCATACACAATCATAAAATTATCGATAGCGATCTCATCTTATCCTCGACCGCGATCAGCATGCAACTCCTCGATCCCG
ATCCAGCTTCGGCCGTCGTGCTTCGATCGAGAGTCAATGCCTTACCTCGGTCCTAGAACCTTGCCTTGTTCTTGGATCACGATCTTAGACGTATAACTAA
CCGTGACCCGGCACCGCAACCTTACCGTGATCCTTGATCGACGTCCTGCGTCGATGCTCGGTCACGGGCCTGCCTGCCGATCTGGCTTGGACCCCTTTGT
CCACAGCGTACTGGTACGTGATCTCGCCAGATCCCGGTCGACCCCGCCTATTTGACCTCGATAAAGTTTGGATCAGTGCTGACCTGGCCTCCTGGCGGGG
GTCAGCGCCCCTGAGTCCTCTCCCACGCCGATCTAGCGAGGACACCGGTGATCTCAGCCCTTTTACCGCAGATCTCCTTCTCCGTACCCTATTCTCCAAC
AAAAGCGAGTGGTCGCAGCTTCTCCGTCCTAGATCGCCTCCTTGAGCCGAAATATCTCCTTCCGTCCATCATCAGGGGCCACCTGGGCAATCGAGGGTTC
ACGTCTCATCAGGTAACTGCAACCTGCGTGATCTCGGGTTGTTGACCCAACAGATCGACTTGGGTATGATCCCTCTGGTTTGATCCGATTCTCTCTCTCC
CAATCTTGGGACTGACGTGGACTTTCTCGGAAATTCTTATTCGCTCTTTACCACATTATTGTCATTGATGCTGACAAGAGTGAACATCGGAGGTTATTGG
AATTAAGGATCGTGATCTGAAAACATACTGGAGACGTGGAAGGCGATGTAGAAATCCGGTCCCGAGTACACAGAGGCAATACGTGAAGGCTCGGAAGAGT
TGTGTACGGGCCTGTTGACGCAAGTAAATCCTTCTTCGCCTAGTTGGTGATATTTCAAATACTCTTCAAATGAATATGTTCTTGGATACAATGCCGGGAA
GTTCTTTTATGCGATTTTAAACTGGCACGGGCCTACATTCTCGTTTCGTTTATTTGTATAGCTTTACATCTCCTGATATGTCATGATAGCAAGGGACGAA
AGGGTGTGTCGCCACGTGATCTTGTGGGCAGAGTGCAGGTCGGAGACACTTACCCCTTTCGCGGCAAAAGGTCACACAATGCGCATATAAAATAGTTTCT
CAGTTATCAAGGGCTGATCAGCTCCCTTATAGGGCGCGTTGTGGGCCCTTTTGCAATAGTTCAACTGATTATGTCCCGTCTTTAATAATACAGGAAGAAC
AGTAGGATACGTAATCATTATGTATAGTTTATCTAAGTTAATATAATGCATCCAGAAGCTTCGCATAGGCTTTGTTACAAGAGATAGGCAAACGGGTACC
ATTATTTAGCTAAAGA