Description :
From Genome Similarity Track
Location :
Scaffold_9:29153- 30211
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G004333Protein of unknown function

Sequence
1058 bases(100 bases per row)
CTTCCAAGTCAACTTGCTTCCAGTATGGCAACAGACAGGGCTGCTGGAAGAGGCCAGGTTCACTCTTCATATCAAATTGTCCAGAGGTTGCAAGCAGCGT
AAACTTCGCAGACCACTTCCTTTCCAGTATTTCTTTTTGATTCAATCCATCAAGGAAATACCAGCACGCTTTCGTATCAAGCACAATGTTTTCCATTGCG
TCGTAGAGAGATCGGTATTTTGTGCCTTCCTCATCTTTCCATTGGTAGTATTTGCCTTGATAGAACAAGCGCGTAATCGACCCACCGAGTTTACCACGTC
CACCAAAAACCTGACGAAACCACACGACTGGTCGCTCCTCCTTGATCGCAATAAAGAAACAGAGCAAGGCCAAGATGCAACTCTTGCCTGTTCCTGGACT
CCCCATGAGAATGAACTGCTTGTTGACCATTTCGCCCGTGTCGAACTCATTTTGATAAATATTCTTGAAATTCTTCAACACACACAGAATCTCTTTCCGC
ATGTAGAATTTGGAGCCAGTAAAGTGCACGATGTCATCGATCACTTTGATGTCCATTACCGTTCCGCAATCGTCATCGGTCCATTCAAACAACTTCAAGA
ACTCGCCTTCCTGGGGTAAGTCGCCAACGTCCACGCACTGCTTCAGTATCATCGCCAAAGAAGTCAGTTTTGGTTTTGGTATCACTTCCGCACCGCTGGT
ACCTTCTGGAACGACCACCAACACATGGATCACCTTCTTTGTCGGTGCACATGCAAACAAATCACCAATCTCATCTGCTGGATCGATTTCTACGTCCAAT
AGGTCCTTTACTTTCTTAGGAGTCTCTCCGCTCCGCATGGCAACCACATCAGGATCGTTCGATGGCAGCCACGCGTCGTCCTTGGCGAGGAACAGCTGCA
GCTTGTCTGCATCGACCGTCTTCAAATCGTTTTCCTTCTCTGCCTTGATCTTCTTCTTCAAGTCCCCCACCGACTGATTCCCATCGATGTCCACAGGGAA
TGCGCTACCCTGCGCTCCGACCAACGCACAGAACAGCTTCACCATCTTTCCTCTTGCT