Description :
From Genome Similarity Track
Location :
Scaffold_208:29149- 31161
Sequence
2012 bases(100 bases per row)
GCGACCAAGACAGGGGGCCAACGTCACCTTTCGACCGAGCGCTCCGACAATATATCGAGCAAACAGCTCGTGAGAAAGCTATACTCGAGAAAATTCTTGC
CACTGAAATCTGCGTGACCACAGACGACGTGGCGAGTTGGCAATCTCCCACGATATCACCCACTGACCCCACTAACAGCAACGAGATCACGCTATACACG
TTTGGAGAATTTTTTACACAATGTCTGCTCTGTGGTGGATCCGATATCCAAGTAATGTGTGTACAGATGGCTGAGCGCTTTGCTCGACTTCTCAAAGACG
TCGTTGGTGCAACATCTGCGCTCGAGGGTATCGTTGCACTTATCATTATAGGTGTTCGGGGGGGCAAAGTCTTCTCGTGTGTTCCGCGCAACGATTCATC
TAGCACACACTGTGTTTCTGACTAAAATGGCAAATACGAAGAAGACAACATCACAATATCAACCTGGGGGTGGCAATACCCAGAATACAAATGACCCTGC
AGCATCTGTCAGTACGTCGTCGCTAGGGCTAATAGAGGAAGTTGGTATCACCAACGTGAGCTATGGGTTGCGAATCATTCTCGAGTCAACACTTGCGAGC
CAACTTTGTTGGTCCTCCATTAACCACGCTAGCAAGCCAACATTTCGTTCGAGTACCAACCCACACAGCCGGAAAGTTTCGGATGGGCTTCCTAAATTGC
CTCCGTCAATCGACAGGGAGTTTCTGTATTTTATCCGGTCGCTGATCGAGCAAGATCTAACACGTGCAAGCTTTTTCGAAGAGCTTCTTGGTCTTACTCC
TACCGACAGTGCTGCCGGGGTCATTTTCACGACAAGCCGATTGCGATTGCTTCGGTTGATCTTGCGGGATGACATGATTCACTGTCGAATTTCAACCAAC
GTGAAGGCCAGTATACACTCGCTTTGCTCCAACTGGTTGATGCCGAAAAGGTCTTCATCCCGTGCTCTGGAAAATGCAAACCTTGATGACAAAGATGCAG
TAGTAATACGACTTGCTTCGGAATGCTTAAATGAAATAGACCGATCGTCTTCAATTTCTCAACAAGCCAAGGATAACGCCAACCTTGTCAAGGGTCTATT
GGTCGCTGTGCCCAAACACCTGCAAGTCGCAAGTATTCTAAACAGACATCGCTCCAACTGCCACTATCACACTGCTGACTTTGTTCAAGACCCGCTTACG
GAATTGGAGATTGCTGAGTTTGCCAAACAAATGCAGCGATACTTTTCATCCCAGCCTCGTCCGAGCGCCCTGTATCGGCACGTATTTGTACGTGCACCTC
AAATTATTATAGAGAAGGATGAAATGGAGCAATGCGAACTGTTTCAAAAAGGCAACATCACTTTCCAAGGGCAAGTTGTTGCCCGAACACCACCGAAAGA
AACTTTTCACGAGGAGATTCAACGAAATGCAGCTTCATTTGTGTTCGACGTTGGTACTCCAAGCAGCACGAAGGTGGCTGGTACAGCACCGCCACACCAC
CAAGAAGTGGTCTCGAGTTTTGCAGCTTTTCGAGGAACAATCGAACAGCGTAGCGATCCCCCCAAACGGACGCGCAAAGTTTCCCCCGAAGATCACTTAC
AACCTCCCAAGACCACCAAAACTCTAGCGGTGACAAGTAATCAACCTGGCAAGAATGCTGTCAGTAGAGCAACCATGATTGTGTCAAGTGATGCAACTTC
TGCTGCTGCTGCTAAAAGCTCAGTTCAGGTCGTAGAAGACTCAACCAATATTGCAGATAACACACTTTTACAGGAAGTACCTGCTGTAGCTCCAACCACA
AGCACCGATTCAGTTTTGCTACCTGTCGCTGTTACACAAGACCCCACCAAGCAAAAAGCAAATCCCTATCAGCCTGAACGGGCCAAAGTCAAAGGCAAGG
AGAAACGCAAAGGCAAAAGCGGTGCTAAAGATCAAGACAACTGCGTACTTCAGTAACAGGCTATCAGCAGCAAGCTAATAACCAGTGCTCTTTCGTGATC
GATAGCTTTGTA