Description :
From Genome Similarity Track
Location :
Scaffold_1:2914438- 2917895
Transcript NameFunction/comments
Physo_322861Hypothetical protein

Sequence
3457 bases(100 bases per row)
CCAAATAATGTTTTTGGGTTAAAATGAGAACTGCTATTTTTGTTTTATGCTTTCTGACTTCCTCTAAATGTAATATTCTAAGATAGGAATCTGCCAACGG
CTGGTTGGCAGAATTCCAATGCTATGCATGTCGCTCATTGGCTAAAAGATGCTGCTCTCAGCCAATAGGAATCCTAAGTCTCTATGGACCACCCGTCGTG
GTGGTCGTAAATGTATGTAGCCTTTGGTGTGTCTACACCAAGGTCGAGAAAGTCTTTCGAACCTCTAACAGACGTCGTATCTGTTAAAGTCACAAGTGAC
TGTAGCCACTTGTGCGTGTAACCCTAAGGTTAGACGCGCCGAGTCACGGCACGTCAATCAGGAAATTGACCATTCGTCAATTCTTCACGTTGGGAGAAAG
AAAACTCGAGCTCATTCCGCAATGAGCTCGCCGCAGAAGAAGACCGCCGCCGCAACAGAGGGTAACCTCTCTGTTGCTCAGTACCATGAGCGCCAGCAGG
CAAAGCGCGACGCGCTCGCTGCAAAGGCCGCGTCGGGGACAACTCAGTCGGAGATTGTCCTCGAAGGTTCCTCTGTAGTCAACGACGCCGTTGACTACGA
AGACGACGACGTGGAGATGGTAGAGAGTGAGGCCTCTTCTAGCAAGCGCAAGGAGTCTATCGACAGCGATAGTCTCGACCCGCATGCCGGGTCGAGACGC
CTTCGTGAAGGAGACGACTCGGACGCTTCGAGCTCGAAGCGTTCGCGCGGCGAGAGCGACACTCCGCTCTCTGCTGCTGGGGCTTTAAGCTCCCCGCGTG
AGGTGGCCCCTTCAAGCTCTCCGCGCGCTGCTCAGTCAGCGCGCGATCCGTGGATGCCGTCTGCGTCAGAGATCGCAGACCGTGTGGGCAACACCGTGCC
TCCAAATGTACGTATGCAGCGGGATCCACGATGATGCTGTGGCGGAGGAGCAGCACTTTGATCCGTTAACGAATCAAAGGCGCGATTACTATATCGAACT
CTTTCACGCGCTCCGATACTTCTCCAGCAAGAAGACCTCTTCTCGCAGCAAAGTGCCTGAGTGGCAGGCACTTTGTCAAAGTTGGAATGCTTTTGTTGAG
AACTTCAACAAGAAGCCGGTTGCTTACCGTGAGCGGGTTAAGCATGCCCGTGAGCGCTTCGAGACATTCTCGACGCGCGGGAGGCTGGAGCAGCTCCCCA
GATCCTCTGTGGACGCTGGTATTCCATGCGCTGTGCCTGAAGGCCATCAGTGCACGTTGTGTCTTCCGGGTGCGGCGCGCTTCAGCGACCGCGACCTAAA
CGGGTACACGACGATTCGTGTACCTGCGAGTCTCAAGGATCTCCGTGCCAAGTTCTTGGCACGTGAGAAACGCGACGATCGTGGGGCCTCGCGCGCTGTA
GGTGACCACAGCGCTCGCACTACCTTCGCGTCGGCAATGCGTGGTGAGCTTCGTACTCCCTCACCATTTCCGGAACGTCCTGCAACAGGACGTCCCGTGG
CTCCCATGTATCTGGTGGGGCGGAAACCCTCTCCAACGAATACGATAACGAACCGGCTGCCGGTTCGTTTTCGGGATACTATGGTTCACAATACGCTCAA
CAATCCAGCGTGTTGAGCCGCGGGCGTCGCGGATCGGAGGCGGCGGTGGTGGGAACACGCCCCGGGTATTGTCAACCTGGGGTTGACCTTGGCCCGACGC
TCGAGGAGCGGGTCGCTGCTGTGGAGCAGCTTCAGAGCCGTGAGTTTGCCGCTCTGAAGCAGGAGATGGCGACCCTGAGAGCTCAAGTTGCTTAGACCTC
GCAGACCGCGTCGGACATCTCTGTCGACGCGGGAGGTCGCGTCGCACGCTTGGCCCAGCGCGTTCACGCGCTGGAGCAGAGGTTCGCTCCTGCTGGGGCT
TCCGCTTCGGGCCAGCCGAGCTAGGTGGCTCGTGCTGCCGGTATGGCTTCAGCCGCCCGACGTAAAAGGTCGGATGGAGGCGCATGCTAGATGGAATATC
TAGCGTGTAGGCGTTGTCATGCTGTGCCAACACCGTGAACGGCCCGATGAAGCGCGGAGCGAGCTTGCTCGCCCCGAAGTCGGAAACTGCATGTTTAGGC
AGGTTTTGAGTTGCTAACAAAACCAATGAACCCTTATTGAATTCATTAGTGTTGCCCCTACCAACATTGTCTGCGTTCAGCTTCTGTCGGTCGACAGAAG
CTGCGATAGCGTCTTGGACAAACCGAATGACGGCTTGTCTGCGCTGCACGAAGTTGATTGCGTCCGAGCTGAACTCGTTCAGCTCGTTTCTAGCAGTAGG
CCCGGCCTCTGCGTTCGTCTTCGCGGTGTCTGTGCCCTGCACAGACCCGTTCTTCTTCTTCTTCTTCTTTTTGCTCTTGTCGGCGTCTGTGCCCTGCACA
GACGCGTGCTTCTTCTTCTTGTTGCGCGTAGTCGCGGCTGACACTGTGCAAGTATCAGCGGCATTCTGCGGCTGCTGTGTTGCTGTCGTAGATCCTCCCC
CACTTAAGGAAGGAGCCACCATCCCGAGTAGACTCGGGAGGCGTGGGTGCCTGATGGCATTCACGTAGAACGGTGTATGCCCGGTCGAGGCATGCACCGA
GTTGTTGATGGCGAACTCCGCCATCGGCAGGCACTCGCTCCAGTGTTGGAACGAGTGAGCGTAGCTCTTAAGCACGTCTACGAGTACGCGGTTCACGCGC
TCGGTCTGCCCGTCCGTCTGCGGATGGTCCGCAGTCGACATCGAAAGTTGACTCCCAAGAAGTGTAAACACTTCTTGCCAAAGGTGTGCAGTGAAGCGCG
GGTCTCGGTCCGACACAATGTCGATCGGCATGCCATGGTGTTTGAACACCATGTCAACGAACAGACGCGCCGTCTGTTTCGCAGTCACTTCAGCGGGTAC
TGCAGCAAGATGTACCATCTTGCTGAAGCGGTGAACAAAGACCACAACGCCCGTGTTCCCCTGGTTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGAC
ATGGACTGCCAACACTCCCGTGGAGTTGGTAGTGACTGCAAGGGAGCCTGCGCGAAAGGCGCAGGCTTCACACGTTGACAAACCTCGCAAGCACGGACGT
ACTTGCGCACCCATTTATACTGGTGGGCCCAGTAGAAGTCTCGCGTGAGAAGAAGGTATGTCTTCTCACGGCCCGGATGCCCCGCAGTCGGCGCATCGTG
ATACTCGTACATGATCCTGAGTCGCAGGTCATGGTCATTGGGCACGACAACGCGGTCCGCGTTGTCGTCGACTGTACTGTAGAGTAGTAACCCGTCGTGC
ACCCGATAACGGTGTGCACGAGCACGAAGATGCTTCGGCAGCTTCTGACGAGCTTTGTCAGAAGGCGCTGAGCCGTAGGCCAGCAAGAGCTTCGCGTCCG
CGTCGTGCGCGTACGCGACCTTCACGTCGTCCAACAGTGACGACGTTGGGGTGCTCG