Description :
From Genome Similarity Track
Location :
Scaffold_1:2914282- 2915674
Transcript NameFunction/comments
Physo_322861Hypothetical protein

Sequence
1392 bases(100 bases per row)
GGACGGACTACAAAGTGCTACCAGGTGTAATGGGCCTACTTTGGCTCACTACTTTAGCTTACACGTGTGCGCGTGCATGTGAGGAAGCGTAGCTTAGTTT
AAATTAGAGTTAATTATACTCGGGCCTCCGAGTATAGATTAATCTAAATAAACGATCCAAATAATGTTTTTGGGTTAAAATGAGAACTGCTATTTTTGTT
TTATGCTTTCTGACTTCCTCTAAATGTAATATTCTAAGATAGGAATCTGCCAACGGCTGGTTGGCAGAATTCCAATGCTATGCATGTCGCTCATTGGCTA
AAAGATGCTGCTCTCAGCCAATAGGAATCCTAAGTCTCTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCCTTTGGTGTGTCTACACCAAGGT
CGAGAAAGTCTTTCGAACCTCTAACAGACGTCGTATCTGTTAAAGTCACAAGTGACTGTAGCCACTTGTGCGTGTAACCCTAAGGTTAGACGCGCCGAGT
CACGGCACGTCAATCAGGAAATTGACCATTCGTCAATTCTTCACGTTGGGAGAAAGAAAACTCGAGCTCATTCCGCAATGAGCTCGCCGCAGAAGAAGAC
CGCCGCCGCAACAGAGGGTAACCTCTCTGTTGCTCAGTACCATGAGCGCCAGCAGGCAAAGCGCGACGCGCTCGCTGCAAAGGCCGCGTCGGGGACAACT
CAGTCGGAGATTGTCCTCGAAGGTTCCTCTGTAGTCAACGACGCCGTTGACTACGAAGACGACGACGTGGAGATGGTAGAGAGTGAGGCCTCTTCTAGCA
AGCGCAAGGAGTCTATCGACAGCGATAGTCTCGACCCGCATGCCGGGTCGAGACGCCTTCGTGAAGGAGACGACTCGGACGCTTCGAGCTCGAAGCGTTC
GCGCGGCGAGAGCGACACTCCGCTCTCTGCTGCTGGGGCTTTAAGCTCCCCGCGTGAGGTGGCCCCTTCAAGCTCTCCGCGCGCTGCTCAGTCAGCGCGC
GATCCGTGGATGCCGTCTGCGTCAGAGATCGCAGACCGTGTGGGCAACACCGTGCCTCCAAATGTACGTATGCAGCGGGATCCACGATGATGCTGTGGCG
GAGGAGCAGCACTTTGATCCGTTAACGAATCAAAGGCGCGATTACTATATCGAACTCTTTCACGCGCTCCGATACTTCTCCAGCAAGAAGACCTCTTCTC
GCAGCAAAGTGCCTGAGTGGCAGGCACTTTGTCAAAGTTGGAATGCTTTTGTTGAGAACTTCAACAAGAAGCCGGTTGCTTACCGTGAGCGGGTTAAGCA
TGCCCGTGAGCGCTTCGAGACATTCTCGACGCGCGGGAGGCTGGAGCAGCTCCCCAGATCCTCTGTGGACGCTGGTATTCCATGCGCTGTGC