Description :
From Genome Similarity Track
Location :
scaffold_50:291424- 298176
Transcript NameFunction/comments
g9384.t1 glycosyltransferase

Sequence
6752 bases(100 bases per row)
GCAGGGATGGCCATGACGCCCGGTGGCAAGATGGACCGCCGCCGCGCCGGCTCCAACTACTTCCAGCTCGACGCGGACCGCAAGCGCAACACGTCGGCCA
ACCGGTCGCACCTGAACGGGGACGGGCGCGGCACGTTCGGCGACCGGCTCAGCATGATGGACGTGCTGCCGCCCACGACGCACGGGGGCAACCAGCTGCG
CGGCGGCGGCCTCGAGGGCGACTTCGCGGACGAAGTGTCGGTGGACTTCTGCTGCGAGGTGCTGTACAACAAGTTCGGCTTCCAGTCGGGCTCGGTAGAC
AACCAGCGCGAGCACGTGCTGCTGCTACTGGCCAACGCCAAGGCGCGCTCCAAGCCGCAGGACCCGCCGGGCCACCACGTCGTGACGCTGCACAAGAAGC
TCATGAGCAACTACACCGAGTGGTGCCAGTTCATCGGCGCGGGGAGCGTCACGTACACGGGACAGGCCCAAGGAGACCTCAAGAACCCGCTGCATATGGA
CATTATGCTCTTCCTTCTGCTATGGGGGGAGGCTGCCAATCTGCGGCACATGCCCGAGTCTCTCTGCTACCTGTACCACCAGGCGGTCAATATGCTCAAC
CAGGACTTCCTCGGACAGCAAAAAGTACCCGAAGGATGGTACCTCAGACAGGTGGTGCGTCCTATTTGGAAGGAGGCCAGCAACATGCAGCGGAAGAACA
GCTTGGGCAAGAACTTGGAGCATACGCAGGTGCGCAACTACGACGACATCAACGAGTACTTTTGGAAAAAGTACTGTTTGAATGTGGATATCACCCACAT
TGGCGAGGAACTGACCAAGAAGCACACCAAGACGTACTACGAGCACCGTAGTATTTTCACGCTCGTGCTCAACTACTACCGCATTTTCCAGTTCAACATG
ATGTTCATGATGGTGCTCATGGCTATTGGCTTCATCTCGGCCATCTCGCCCAGTGGCGGCCAGCAGTGGTTTGCCCAGTTTGGCTCCATGGGCGAGGTGG
TGGAGCCCTACCAGCAGCAGGACGTCAAGCTCACGTACGTGGGGATTGTGTGCGCGCTCTCCACCATGGGATTCTGCAAGACCGTCTTAGAGGCGTGTCA
CGGATGGCATTTGCTCACAGCCAGCGAGGCTTCCGCTACGTCGTCACGGTCGTTCAACTACGGAAGTGCACTGGTTGTTCGTATGCTCTGGAACGGAGCG
TTCGCTGGCATCTTCGGGTTGATGATTTACACTCCACTCATCACGAGCAAGAACACTGAGCTGTTGGACAAGGCTGCTCCAGCGTCAATTGCCTACATTA
TGCCTGGCGCCTTGATCATGACTGTCCAGGCTTTTGCCCCGTCGATGGTCACCAAGACGTTCGCGGCCAAGTTCATCCGTGAAGGTGAGTCGTGCTTCGT
GGGACGCAACATGGCGCCTCCGCTCAGCTACCAGATCAAGTACATCACGTTCTGGGTGATTCTGTGGGCGCTCAAGGCGTTCGTCTCGTACTTCATCCTG
GTGCGTCCGCTGGTCTTGCCGTCGCTTGCCATCTACGAGATGGATCTCGAGTACGGTAGCAACGTTGTGTCGTTCCACAACTTCGGCGTGATCCTGGCGC
TGTGGATGCCGGTGGTGTTCATCTTCAACTACGATACCCAGATCTACTTCACGATCTTCCAGGCTACTCTCGGTGGTATCCAGGGCCTTATCATGAAGAC
AGGTGAAATTCACGGCATCAAGGAGATCACGAAGGCCTTCCGCGTCGCGCCTCAGCTTTTCGACCAGAAGGTGGTGACCAACCTCGCTCGCTCGAACGAT
GCTGCCGCCGATGGCTCTGCTGCCGCGTACCAGTCGCAGATGATGCTGCGCTTCGTGGTCGTGTGGAACGAGATCGTGAACTCGTTCCGCGAGGGAGACC
TGGTGGACGATAAGGAAGCTGCCATCCTGCAGTACGACATTCAGAGCTCCGGCGATGTGTTCGAGCCTGTATTCCTGTCTGCTGGAAAACTGGTGGAGGC
CCTCGACTACACAGTCAAGCTGGCTAAGGAGGGCAAGGGTGACTCGCAGCTTCAGGTGTACATGGTGCAGAAGGATTGCCTGTCTGCGGTGCGCAGCTTC
TTCACGGCCAGCATGTACGTGATGGAGGCTCTGCTCGGCAGCGACGATGCGGACATCCTCGACGCGCTTCGCCAAATGGAGGCGATTGCTGCCAACGGTA
GCTTCATGAGCACGTTCGATGCCAAGAGCCTTGTGCAACTGCGCACTGTGTCCATGGAGTTCTTGGAGGCCGTGATGGATCTGCCTGACCCGGATGCTCA
GTCCTCGCACTTGACGACATCCAGGGTGCACACAATGGGTGTCGTGCGTAACTTCGTGACGAAGATGGAGAACTTGCTCAACGCCATCCGCATTCTAGCC
AACCGCCCTGAACTTGCTGCCAAGTTCAGCAACTCCAAGTTCTGCTCGAGCGCGAACGGCTACGTGTTTGCTGCCCGTGGTCTGGTGAACCTGTTCCACA
ACGACACGGCCATGGGTGCTGCTACCCGCGCGTACCTGCTGATGTCACTTGAGAAGGCTGATGCGATGCCGCGCGTCCCTGAGGCTCAGCGTCGTCTTGG
TTTCTTCATGAAGTCGCTTCTGATGGACATCCCGCAGCTGACTTCGGTGAAGGAGATGCATTCGTTCTCTGTCGTGACCCCTTACTACAGTGAAAGTGTG
CTGATCTCGCTGTCGGAGCTGAACGATCCGCTAGTGAACCACCCAGTCTTCAAGAAGGTCGAAGAGAAGGGCAAGAACATTACGATTCTCAAGTACCTTA
TTACGATTCACCCGGAGGAGTGGGAGAACTTCTTGGAGCGTATTGATGTGGGCTCGGCTGAAGAAGCGCAGGCAAACTACCCGCTGGAGATTCGTCTCTG
GGCTTCGTACCGTGGTCAGACGCTGGCGCGTACCGTCCAGGGTATGATGCTGTACGAAGATGCCATCAAGATTCTGCACTGGCTGGAGATTGGCTCGAGC
CCCGGCAAGACGGCCGAGCAGAAGCAGGCTCAACTGGAGGACATGGTGCGCCTGAAATTCTCGTACATCTGTGCCTGTCAAGTGTACGGTAAACACCGTG
CTGACAACAAACCTCAGGCCGATGACATTGACTATCTTCTGAAGACGTACCCGAACCTGCGTGTGGCGTACGTCGACACCATTGCGTCTGACGGAGGCAA
GCAGTTCGACAGTGTGTTGATCAAGAGCGAGGGCAACGAAATTGCTGAGGTGTACCGTTACGAGCTGCCCGGCGATCCGATTCTTGGTGAGGGTAAGCCC
GAGAACCAGAACAATGCACTTCCGTTCACACGTGGCGAGTACCTGCAGACAATTGATATGAACCAGCAGCATTACTTTGAGGAGTGTCTGAAGATGCCGC
AGCTTCTGGTGACCGCTGACCTGCACCCTTCGAAGAAACCTGTGTCGATTATTGGTATGCGTGAGCACATTTTCACGGGTAACGCTTCGTCGCTGTCGAA
ATTCAAGTCGTGGCAGGAGCTGGTGTTCGTGACGCTGTCGCAGCGTGTGCTGGCCGACCCGCTGTACGTCCGTATGCACTACGGTCACCCTGATATTTTC
GACAAGATTATCGCCATGCCTCGTGGTGGCGTGTCCAAGGCTAGTAAGGGTATCAACTTGTCCGAGGATGTGTTTGCCGGATTCAATGCCACGCTTCGAG
GTGGTGTGGTGACCCACGTGGAGTTCATGCAGTGTGGCAAGGGTCGTGATGTGGCGCTCTCTCAGATTTCGATGTTCGAGGGTAAGCTGGCTAACGGTGC
CGGTGAAACTGCGCTGGCGCGCGAGGCTCACCGTATGGGCCAGTTCATGGATTTCTTCCGTCTGAACTCGATGTACTACTCGCACACGGGTTTCTACTTC
GCAACGTGGATGACGATTGTGACGACCTTCGTGTACATGTACTGCAAGGTGTACCTGGCTCTGGCTGGTGTGCAGCAGCAGATTGTATACGACATGAACA
CAACTTCCGTGATTACCGAGAACATTGCCAACAACTTCGACGAACGTGTGTTCACGGACCTGAAGGCTGTGTTGAACACTCAGTTCTACATCCAAGCCGG
TACCTTCTTGATGCTTCCGCTGATGTGCGTGTACTTCGGTGAAGGTGGTCTGGTCCGTGGTATGACGCGCTTCATCGACATGATCATCACGCTCGGCCCT
GCGTTCTTCGTGTTCCAAGTCGGTACGACGATGCACTACTTCGACAACAACATCGTCCACGGTGGTGCCAAGTACCAGGCCACGGGTCGTGGTTTCAAGA
TCTCTCGTGAAACACTGGTGTTGCTGTACAAGGCGTACGCAAGCTCACATTACCGAAAAGCTTGGGAGCTTATTGGCTTGTGTCTCGTGTACTTGACGTT
TGGTAACTTCTACATCTGTCAGACGGATGCCTCGGCCAACGACAACACCTTCGCGTCCGACTACTGTGATACTTCCCAGGCTTACGGTGTGCAGACGTTC
TCGGTGTGGTTCATTTCCATTCTGTGGGTTGTCGGTCCCTTCCTGTTCAACAGTGATGGTCTTGACTACAGGAAAACGAAGGTGGATATCCAGCAGTGGT
GTATGTGGATGTTCGCTCCCGAAGACTTCCAGGACGACGATCCGGCAAACAAGGGCGGCTGGGTAGGCTGGTGGAAGGGCGACCTGGAGCAGCTCCACGC
CTCGAACATGATTTCGCGTGTCACTGTCATCCTCCGAGAGTGCCGGCACTTCCTGCTGATGTTCTACGTGGCTACACTCGAGACGTCTGACGTGATGTAT
GTCGCCTACTCATTCGGTGCTGCCGTTGCGACTGTCGTTCTGCTGGGTGTTTTCCATGGCATCGGTGTGGGCATGCGCTCCATGAGCCCTGTAACTCGCG
CGATGATTTACTTAGGTACCATGACCATCTGGGTCACGGCGTACTTCTTGGCCACTAAGATTGTCTTGGACTGGAGCTTCACGTACGCAATTTCGTTGTT
CTTCGCCTACGTGGCTGCCTTGTACGGCATCAACGAGTGCTTCCGCATGTGGAGCTTCCCAGGCTCCTCGATCGCCAGCATCCCGATGTTCCAGCAGCTG
CAGTTCCTGTTCGACTTTATCTTCTGCACGGGTATGATCATCCCGCTGGTGATCTTGTCCTGCATCCCGTTCTTGAACGTTATTCAGACGCGTATGATGT
ACAACGAAGGCTTCTCGAAGGTCATGTCGGCATCGTCGCAGTACGCGTTCTCGCTGGCCGCCTTCATGGGCATTCTGGGTGGTATTGGTGTTGGCTGGCT
GTTCAACCTGCTCTCGACGCTGGAGCAGTCGGCAAGTTTTGCGAGTTATGTGGTGACGTACGACGGCGTGCTCAGTGGCAATGTTGGCGACGGCACGACC
ACCTTCATGCTGTACGGCGCCTGCGTTGTCGGCACGATTATTGCTGGCTTCTTGAACTACTTCCTCGGCCGCCGCTTGTCCATCGTTGCCGGTGGTCTGT
TCAGCACGCTCGGTATGGTGGCTGTCAGTGCCAACGACGACCTTCGTTCAACTCTGCTCATGCCTGGCATTGGTCTGCTCGGCGCGTCTTGCGGTATCCT
GCTGCCGTCACTGGCCATCTACATCTACGAGATCTCGACCAAGGAGATGCGTGGCAAGGCTATCTTGCTGCTGGGCATCGGCTTCATTGCCGGTAGTCTG
CTTGGTGGCATTTTCGCGACTGTGAACCAGTTGGGATGGATCTGGCAGACGTTCGCTGCCTGCATCGTCATTGCGTTGGTCACTCCGGTGGTGAACGTGT
TCCCCGAGAGTCCGTACTGGGTGCTGGACCGCAAGGGCTGGGACGCGTGCGAGGCCTGCCTGGTCATTCTGCGTCGTAAGCCTGACGTGCACGACGAGCT
CAAGATCATGCGCGAGGAAGAGACCGCTGACGAAGGTGGCTCGGGGCCGTTCAAGTTCCTGATCGGCCTGTTCCTCATGCTGGTTTCGGCGCTCACGACG
GGCTTCTTGAACGCCTTCATCAGCTACAAGGGTGCCAGCGAGTACACCGACCAGGACCAGTTGTTCGTGAACGGCATGGCGCTGCAGATCTCCGGCGCGG
TCATTTCCTTCTTCTTCATCGACAAGCTGGACCACAAGTCGATCCTGTTCGCAACGCTGATCCCCGTGGCAGGCTGCGCGGGCTTGCTTGGCTTCAACGA
GTCGTCGGATCTCCTCGGCAACCCGGAGGGCTCGGGCCTGTACGTCAGCCTGGTTGTCATGCTCATGTACTTCTTCATGGGTCTGGGTACGAGCTCGCCC
CCTTGGACGGCGTGCGTCGGCATGTTCACGACGCGAGGTCGCGCCTCGTCGACAACGTTCCTGTTCGCGATGTTCTACTTGCCCAACCTGGGATACGTGT
ACATGCACACGCACGACTCGATGATGGCGAACGAGTACTTGTACCTGTACGCGATCGCCGGTCTCTGCGTCGTTGTACTCGTCCTGCTGCTGGGTGCTGG
TACCAAGAAGAACGGCGTCATCTCGACCAAGGCTGAAGGCGAGCGTGACCGCGAGCGTGCTGCTCGTATGCGGGCCGATCGCGCGACTCGCGCTTCTCGT
ACGCCAGGTGCGCGCCAGCGGAACCTCAGCCGCGTGCGGTCCAAATCCAACGCTGGCGGCCAGCGCGGCAACGCGACGCCCGGTGCCGGCTACCAAATGT
ACGAAACACCCGCGCACGCTGCGCCGCCGCTCACGCACGCACGCGCATAAAG