Description :
From Genome Similarity Track
Location :
Scaffold_2069:2914- 4953
Sequence
2039 bases(100 bases per row)
ATCAAGCGAGTCAGTGGAGGCATGGCCTGCGACGATTCCCCCGGAGGTCGAACGGCAGACAGGTCTCGGTGGTCGtcatcgacttcttcgtcgctggaaT
CGGTGCATCCAGCGGCTGCCATGCCAACACCGCTGGTGACCGCGACCTCTTCAACCTCTTCGTTACCTGCACCCCCGCCACCGACCCTCGAGTTGATACG
TGTCGCGTAGGAACATGCCTAAAATATGCAGGTACACTccccaccaacaacactcGCTGAGTCCACGAAGAATCAGTGAGCTTGTCGGGCAAACAGAACC
TGAAGGCCCAGGATTTGCCCTTACGCCGGGTTGGTTGTTTCCTCTGTGTACCATTGGTTTCCGTAAGGCTAACGAATATATCAGCACCACTAgtcacgag
cgacgactAGGGTGCTCCTCTCACGCAAAATATACCTCGCAGGCCCTCACAAGGAAGGGTCCCAGCCAGTCACGGCTTGATACGAGGGTGCCNTACTAtc
tcttggccttgccggACGGATGAACACTCACTACACTAGTAGGCGTGCTCACCGACAGACATGATCCCCCCTACCAGGTTTATCCCGTCGCTACGTGTAC
TTACCGATAGCCGGACATCGCCCTTGAGGTTGAGAGGAAAAACTGTTCTGTTATTAGTTGCCCGATGGCCATATGAATGATATCTAGATGCTCCAATCGT
CCTTTACAAATATCAAGTATAAATGTGTCCGTTTCGGATCTTTCGAGTAGCCACCGACTCCTTGGAGAGGCGCTGAAGCCCCCACGAGTCGTCCTGAAGA
CTTGGACGACCGCCTGAAGTGGTACCGGAGGCTTGGAAGGGTCACCACGTGGCTGCCTAAGACTCGTCGAAGTACGGATATCGGCGGTGGTTTGGTCGGC
CCGAGTCTTCGTCACCGGCCtattttgaccaatcagcgACGGGGGATTCCACTGGTGTCACTGCCGACAACTCTTGACATGGCCAATACCTGGGACTTGC
CGATCGGTGTAGGCTCTTCTCTTGCGGTGATTTACTACACCGTATACGCGTTCTCGGCTGGCGTGTCCGCTTTGGTGTCGCCACTTCCGCGGCtggtgat
ggtgctgctgctggagggtTCAACCGTCGGGGTGCTCTGGCTACTCGTGCTGCAATATTCTGCTATTTCTTCAGTTTGTTCAGTACACGCATGCCTCAGT
TGCTCTGCTCTTGTGTTTGTCCCCGCTCCACTCTCCTCTCCCCCTCTTCTCTCCCCTCCACTCTGCTCTGGTCTACTCCATTCTCTCGTCTCCGTATCTC
TCTGTGGTCTGGGTTCGCGCCGCCAGACCAAGCTTTAGATTGAAGGTTTCCGTATGCAAACCATCAAGTAAGCGCTCCTCTTGTATCGGCTTAGTTCTGG
GTCGTCGGTACTTGTCGACAATGCTGTGGCTACACCCGTACGTGACTCcggacctgctgctgaccaGGGAATGGTGACCGGTGGCAACAACCGCAGACCG
CCACTAGCTAGCCTAACTGAAAACGAAATATACAGACGGCTTACGGCTGTTTTCCATGTGCAGTTCTGGTGTCGAAGTCCTGGTCCGAAGATCTACCGAG
CCGTGGAGTGGGGCGCCGGGGGTTAAACTGCCTGGGCTCTTAGTACCCTCCCTTTGGCTCTGGGCACTCCGTACGGGCTGTAGATGCGTCAGCTCGTGTG
GGGACTGCTGATACCCACCTCCTTACACACTACGATGAATCTCGACCGCACGTTAGACTAACTTCTGATTTGCTACATACAGCAGTTACGTGTTACTTCT
TATCCTGCTGCGAGCTTTGCGTACTTCGCCGCAAGTCTGGTTGGGCCGGTCGCCGGTTCATGTACCCGCCGATCTGAGGCGGTGGGCGACTGCTCGCGCG
AGATCACAGGTGCACAGTGTGccggccacgtcgcccagctGCGTTATTGGTCTCCTGCGCCTCCGTGAACCCCGCTTCACCACTCCTGGCCGCGCCCCTT
CAAGATACGCGATCTTCTCCCCAGCGTCAAAGCCGATGC