Description :
From Genome Similarity Track
Location :
Scaffold_51:29139- 32584
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_51-fgenesh-gene-0.730S ribosomal protein S16
Pytve_DAOMBR484maker-pve_contig_51-snap-gene-0.49Nucleolar protein

Sequence
3445 bases(100 bases per row)
ATGGTGGTGAGACTCCGGCTGGCGCGCTGGGGCCGCAAGGACCTGCCCTTCTACCGCATCGTGGCGGCCGACGCCCGCGCGCCGCGCGACGGCAAGCACC
TCGAGATCGTGCGTTCTCTCTCATTGTCTGACCGAGCAGACTCGACGAAGTCATGTACTAACCATTCCCTGCTTTTGCTTATCCCTCACCAGCTCGGCAC
GTTCAACCCGATCGCGGCGAGCGACGGCGTCAAGGAGCTTCGCGTGAACAGCGAGCGTGTGCGCTACTGGATGTCTGTCGGCGCGCAGCCGTCGGACCGC
GTGGGCCACCTGCTCGGTCTGGCCAACATCTTGCCCATGCCGCCGACACGCCAGTTCGGCAAGAAGAGCGTGCCCAAGAAGGACCGCGCGGCCAAGTAAG
CATGGTCAGCGAGTCGGTTAGCATGCACGGTTAGCAACTCCGCCGTCCGCAGAGCCGCCGTAATAGAGGACGATTTGCTATCCTGTCCACATATGTGTCC
TCCATCGACCACCACCAAACAAACACCCAGACATTGTGAACACATTCCAGTAATGATGTATGGGATCTATCGCGCCTAATGAGGCCTCCTCCGCCGCGAA
GGAACATGCGGCATTGACCGCTACTTGCGCGGCGTGCGGCGGTTCTTGGCCGGACCACCCGAGCCGCCGCCCTTGAGCATGTTGCCGCCCTTCTTGACCT
GCTGGTTGAACGTCGCGTGCTGCTCCTCGAGCCACTTCCAGATCTCCTTCTGCTTGGCCTGCTTCGCCTCGAGCCGCACGTTCTCCTCCTGCTGCTGTGC
GCGAGCCACGAACTCGGCGTCGCGTCGCAGCTCGCGAGCCGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGTCCTTGTCGCGCGTCTTGTCCTTGCGAACCGTGTAGTTCTCGTCGAACTTGGGGGCGAACGTCGGCAGCACGCTCGGCGCCGCCGTCTGCAGG
CGCAGCGGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGGAGCGACGCGATGGCCGCGT
TCAGCTGCGACTGGTGGCCGTCGAAGGTCGCACGCGCCACCTCGTGCAGCAGCAGGTACAGCGGCCGGAAGAGCTCCTCGAACGCTGGCAGAGCCGCGTA
CTGCGCCGACGTCGCGTCCACGAGCGCCACGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGCTGAGCACGGCTTCGGCGCTGGCAGACGA
CGCAGCCGCGAGATCGAGCGACGGGAGGGTCTCGTCGGCTGCGTGGGTCTCGCGGTAGGTCGCGAGCTCGCGGTGCAGCCAGTTGGACGCGCTGTCGGTC
GAGGAGCCGGTGAGGAACGCGCGCACCAGCCGACGCAGCGCCACGACCACCTCCGGAGCGAACCGCTGCTTGTCGCGGGCCATGTCGAGCAGCAGCGCGC
ACGTCGCGAGCGCCTCGACCGCGTCTTGCGGAGTCTCCAGCCGACCACGCACGAGGCTCTCGGCCAGCAACGTCTCCATCGGCGACACGACGTTGTGGCG
CAGGTCCGAGGTCGGGAAGACGCGAGCGAGCGCCTTGAACAGCAGCACCTCGGCGAGCTGCGGCCGCCGAGAGTCACGGCCAGCCTTGGAGCCGTGCAGC
CGCTTGAACAGGTTGGCCAGCAACTCGCGCGTCACGACCGCCGCGTCGTTGCCGAGCTGCTGCGCCAGCGAGAACAGGTGGATGGTAAGATGATCGAGCT
GTCAGAACGCACACACATCAAGAGAGGTTAGTATTCGACCAGACCGTCACACCACTCGAATAAAGGCAAACGTACGTCTTCCTTGTGGGCGGCATACCGA
CCAGCGTAGCGCAGGAACTGGCGCACGAGGATCGCGAAGAACGTCTTCATCTTGTGCTGGTTCTCGACGCTCAGTCGGGGCGAGTAGTACGCCAGCAGTC
GCTCGACAATCAGCGAACGAATGGCCGGCGACTTGCGACCATGAGCCTTGAACAGCTCGCTCAGCTCCTCGGGAGTCTCTGGACACGGGAACACGTACGG
CAGCTCGTCCGCCGCCTGCTTGGCGCGCTCCTCGGCCTTGTCGACAGCCTCTTCGTCGTCCGAGTCGTCGTCTTCCTCGTCATCCATCTCCTCCGCCGCC
TCGTCGTCGTCAGCAGCCGGAGCCTTCGCGTTGTCGCCTTCGTCGTCGGACTCGGCCTCCGAGTCCTCCTCTTCTGACCCGTCATCTTCATCCTCATCTT
CATCCTCCTCGTCTTCATCTCCTTCTTCCTCATTGTTCTCGTCTTCTTCGCCCGCAGCACCAAAGCGCTTGTCGACCTCGTATCCTTCCGCGAGGTCATC
GTCGGTCGGTGGCATGATGATCGTCTGCGGCGCCTTGGTCTTCTTGGCCTTCTTGCCCTTGCTCTTCTTGCCGCCTGCTCCTTCCTCGTCGCTGTCGTCC
GCGTCCTCGCCGTTCATGCGCGCCACACGCTTCTTCTCGAGCTCGGCGAGCCGGTCGTGCTCCTTCTTGGCCGCCTCCTCGGGCGACAGCCGGCGCTCCG
TAGCCTTCGCCTTCGCCTCGAACGCCAGCTCGCGCGTCAGCTTGTCGAACTCGTCCATCGGTCCCTTGTCGGGAAGCTCCTTGCCACTCGCGCGCGTCGG
GCGGAACTCGAGCAGGCCGCGGATGTCGTCGAAGCCGTCGTCGAGCGCCTCGGTCGCGTCCACCTGGGTCGCCTTGGCCTGCTGGCGCTCCGCCTTGAAC
AGCTTCGCCTTCATCATCACCTCGTGCATGACCTCCTTGTGCGTCTTCTTGACTCCGTCCTGAGCCTCGGCCTTCTCTCCGTCACCTCCACCAAAGTGCA
GCCGATCAACGATCTCCCGGTCGAGCCGCCGTCCTTCCTCGTCGTTGTCCTCGTCATCCAGCGGCGCGTCCGCGTTCAAACGGTCGTAGTCGTCGATCTT
CTGGCCGCCGTGCGTCAGGAACAGCTCCTCGTCCTCCTCGTCGCCCTCCTGGTCCGAGTCCTGCAGGTTGAACGCCGACGCGTTCCGCAGCTTGCGCTTG
CGCTCCGACTGGAAGCGGGCCATCATCTTGTCCTCGAGCGACAGCGTCGGGTCCTGCTCGCCGAGCCGCCGGTCGCGGAACTCATTGCGCTTGTTGCGCG
ACTGGAACTCGGCGCCAAGCGTCTTGCGGCGCTTCGCCTCGGCCGCCGCTCGTGCCAATGCGACATTGCGGCCGGCACCTTTGACACGCTTGCCGAGCAC
CTCGTACTTGGCCTTGGCGTTGCTGCGCACGTCGAACGGGTTCGGTCCGCCGACCTTGGCGACTCGCTTCGCGCCCGCGGGCTTGGCGCCGGAAGCCTTG
CCCGACGGCTTCTTGCCGCCGCCCTTGCGCTTGAACGCCATCGTG